View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9011_high_68 (Length: 211)
Name: NF9011_high_68
Description: NF9011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9011_high_68 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 7415659 - 7415481
Alignment:
| Q |
15 |
cagagatcttcaagaaagcaaccgaggagctagatagagtgataggaaaagatagatgggttgaagagaaagacattgcgaatttaccttatgtttatgc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7415659 |
cagagatcttcaagaaagcaaccgaggagctagatagagtgataggaaaagatagatgggttgaagagaaagacattgcgaatttaccttatgtttacgc |
7415560 |
T |
|
| Q |
115 |
aattgctaaagaaacaatgaggctacatcccgtggcaccatttttagtgccacgagaagctagagaggattgcaaagtt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7415559 |
aattgctaaagaaacaatgaggctacatcccgtggcaccatttttagtgccacgagaagctagagaggattgcaaagtt |
7415481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 7423318 - 7423144
Alignment:
| Q |
15 |
cagagatcttcaagaaagcaaccgaggagctagatagagtgataggaaaagatagatgggttgaagagaaagacattgcgaatttaccttatgtttatgc |
114 |
Q |
| |
|
||||||| |||||| ||| || ||||| ||||| | ||| ||||||| ||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
7423318 |
cagagattatcaagagagctacggaggaactagacaaagtaataggaagagatagatgggttgaagagaaagacattgtcaatttaccttatgtttttgc |
7423219 |
T |
|
| Q |
115 |
aattgctaaagaaacaatgaggctacatcccgtggcaccatttttagtgccacgagaagctagagaggattgcaa |
189 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||| ||||||||| |||||||||| ||||||||||| |
|
|
| T |
7423218 |
aattgctaaagaaacaatgaggcttcatcctgcagcaccattgttagtgccaagagaagctagtgaggattgcaa |
7423144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 7429727 - 7429553
Alignment:
| Q |
15 |
cagagatcttcaagaaagcaaccgaggagctagatagagtgataggaaaagatagatgggttgaagagaaagacattgcgaatttaccttatgtttatgc |
114 |
Q |
| |
|
||||||| |||||| ||| || ||||| ||||||||||| ||||| | ||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
7429727 |
cagagattatcaagagagctacagaggaactagatagagtaatagggagagatagatgggttgaagagaaagacattgtcaatttaccttatgtttttgc |
7429628 |
T |
|
| Q |
115 |
aattgctaaagaaacaatgaggctacatcccgtggcaccatttttagtgccacgagaagctagagaggattgcaa |
189 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||| ||||| | ||||||||| ||||||||| ||| ||||||| |
|
|
| T |
7429627 |
aattgctaaagaaacaatgaggcttcatcctgtgacaccaatgttagtgccaagagaagctactgagaattgcaa |
7429553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University