View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9011_low_126 (Length: 271)
Name: NF9011_low_126
Description: NF9011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9011_low_126 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 35 - 271
Target Start/End: Original strand, 47386862 - 47387098
Alignment:
| Q |
35 |
ctgacacaggttttgcaattaaggtaactttcactattctgggtgctttggtgggtctccatctgtttgttgaaaaacctaaaccaacaaaatgaaggat |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47386862 |
ctgacacaggttttgcaattaaggtaactttcactattctgggtgctttggtgggtctccatctgtttgttgaaaaacctaaaccaacaaaatgaaggat |
47386961 |
T |
 |
| Q |
135 |
tttccttcttgttttggtgaaaatggtgttcaagttgcggattcttcttcatcgtcttcaagtgctgctagaaatgctcagaataacatggttacttgtg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47386962 |
tttccttcttgttttggtgaaaatggtgttcaagttgcggattcttcttcatcgtcttcaagtgctgctagaaatgctcagaataacatggttacttgtg |
47387061 |
T |
 |
| Q |
235 |
tttaccaatgccggatacgtggtaggtcgtgtccgat |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47387062 |
tttaccaatgccggatacgtggtaggtcgtgtccgat |
47387098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 126 - 197
Target Start/End: Complemental strand, 38018117 - 38018046
Alignment:
| Q |
126 |
atgaaggattttccttcttgttttggtgaaaatggtgttcaagttgcggattcttcttcatcgtcttcaagt |
197 |
Q |
| |
|
|||||||| ||||| ||||||||||| |||||||||||||| ||||| ||||| |||||||| ||||||||| |
|
|
| T |
38018117 |
atgaaggagtttccatcttgttttggagaaaatggtgttcaggttgcagattcatcttcatcctcttcaagt |
38018046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 123 - 196
Target Start/End: Complemental strand, 36162697 - 36162624
Alignment:
| Q |
123 |
aaaatgaaggattttccttcttgttttggtgaaaatggtgttcaagttgcggattcttcttcatcgtcttcaag |
196 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||| || || ||||| || || || |||||||| |
|
|
| T |
36162697 |
aaaatgaaggattttccatcttgttttggtgaaaatgcagttcaggtagcagattcatcatcgtcttcttcaag |
36162624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 39214825 - 39214792
Alignment:
| Q |
1 |
tttctactttcaattttccatctatatagtttaa |
34 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
39214825 |
tttctactttcaattttccatctttatagtttaa |
39214792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University