View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9011_low_140 (Length: 226)

Name: NF9011_low_140
Description: NF9011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9011_low_140
NF9011_low_140
[»] chr2 (1 HSPs)
chr2 (1-215)||(23466539-23466753)
[»] chr3 (1 HSPs)
chr3 (99-135)||(47193735-47193771)


Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 23466753 - 23466539
Alignment:
1 ccagaaaatattctcttggacgagacttttagagcacttgtttcagatttcggtcttgcaaagctaactggtaaagacgaaagtcaagcggtgtctacaa 100  Q
    ||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||    
23466753 ccagaaaatatactcttggatgagacttttagagcacttgtttcagatttcggccttgcaaagttaactggtaaagacgaaagtcaagcggtgtctacaa 23466654  T
101 taagaggaacacgaggttatatggcacctgaatggcttttagaaaagggtatttcagatagaactgatgtatatagttacgggatggttttattagagat 200  Q
    ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
23466653 taagaggaacaagaggttatatggcaccagaatggcttttagaaaagggtatttcagataaaactgatgtatatagttacgggatggttttattagagat 23466554  T
201 tgttggagggagaaa 215  Q
    ||||||||| |||||    
23466553 tgttggaggaagaaa 23466539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 135
Target Start/End: Original strand, 47193735 - 47193771
Alignment:
99 aataagaggaacacgaggttatatggcacctgaatgg 135  Q
    ||||||||| ||| |||||||||||||||||||||||    
47193735 aataagagggacaagaggttatatggcacctgaatgg 47193771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University