View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9011_low_141 (Length: 226)
Name: NF9011_low_141
Description: NF9011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9011_low_141 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 23466753 - 23466539
Alignment:
| Q |
1 |
ccagaaaatattctcttggacgagacttttagagcacttgtttcagatttcggtcttgcaaagctaactggtaaagacgaaagtcaagcggtgtctacaa |
100 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23466753 |
ccagaaaatatactcttggatgagacttttagagcacttgtttcagatttcggccttgcaaagttaactggtaaagacgaaagtcaagcggtgtctacaa |
23466654 |
T |
|
| Q |
101 |
taagaggaacacgaggttatatggcacctgaatggcttttagaaaagggtatttcagatagaactgatgtatatagttacgggatggttttattagagat |
200 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23466653 |
taagaggaacaagaggttatatggcaccagaatggcttttagaaaagggtatttcagataaaactgatgtatatagttacgggatggttttattagagat |
23466554 |
T |
|
| Q |
201 |
tgttggagggagaaa |
215 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
23466553 |
tgttggaggaagaaa |
23466539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 135
Target Start/End: Original strand, 47193735 - 47193771
Alignment:
| Q |
99 |
aataagaggaacacgaggttatatggcacctgaatgg |
135 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
47193735 |
aataagagggacaagaggttatatggcacctgaatgg |
47193771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University