View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9011_low_157 (Length: 202)
Name: NF9011_low_157
Description: NF9011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9011_low_157 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 7e-88; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 20 - 187
Target Start/End: Complemental strand, 41805660 - 41805493
Alignment:
| Q |
20 |
cattgcgctccctgtgataatcaatccgcaaacaaagctgcctgatggcctccctcttttcctctcccaagttcaacataccctcctctttctcttccat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41805660 |
cattgcgctccctgtgataatcaatccgcaaacaaagctgcctgatggcctccctcttttcctctcccaagttcaacataccctcctctttctcttccat |
41805561 |
T |
 |
| Q |
120 |
caacttctctagctcttcaactcacttcttaagttcaacaacaattgttgtcacattcatcttctctg |
187 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41805560 |
caacttctctagctcttcaactctcttcttaagttcaacaacaattgttgtcacattcatcttctctg |
41805493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 99; E-Value: 4e-49
Query Start/End: Original strand, 33 - 187
Target Start/End: Complemental strand, 41799261 - 41799107
Alignment:
| Q |
33 |
gtgataatcaatccgcaaacaaagctgcctgatggcctccctcttttcctctcccaagttcaacataccctcctctttctcttccatcaacttctctagc |
132 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| | ||| || || ||||||||||||| |||| ||||||||||| |
|
|
| T |
41799261 |
gtgataatcaatccacaaacagagctgcctgatggcctccctcttttcctctcccaaatccaatatgccttcctctttctctttcatcgacttctctagc |
41799162 |
T |
 |
| Q |
133 |
tcttcaactcacttcttaagttcaacaacaattgttgtcacattcatcttctctg |
187 |
Q |
| |
|
||| ||||| ||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
41799161 |
tctccaactgtcttcttaagttcaacaacagttgctgtcacattcatcttctctg |
41799107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 33 - 187
Target Start/End: Complemental strand, 41812477 - 41812323
Alignment:
| Q |
33 |
gtgataatcaatccgcaaacaaagctgcctgatggcctccctcttttcctctcccaagttcaacataccctcctctttctcttccatcaacttctctagc |
132 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| | ||| || || ||||||||||||| |||||||||| |||| |
|
|
| T |
41812477 |
gtgataatcaatcaacaaacagagctgcctgatggcctccctcttttcctctcccaaatccaatattccttcctctttctcttttatcaacttctgtagc |
41812378 |
T |
 |
| Q |
133 |
tcttcaactcacttcttaagttcaacaacaattgttgtcacattcatcttctctg |
187 |
Q |
| |
|
||||||||| ||||||||||||| ||||| ||| |||||||||||||||||||| |
|
|
| T |
41812377 |
tcttcaactgtcttcttaagttcatcaacagttgctgtcacattcatcttctctg |
41812323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University