View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9011_low_48 (Length: 482)
Name: NF9011_low_48
Description: NF9011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9011_low_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 1e-76; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 130 - 311
Target Start/End: Complemental strand, 10367172 - 10366992
Alignment:
| Q |
130 |
gtcgatatttttctctctgattttggatcacattcctttgagcacacttccttgtaactattgtttgtttgttcctttactgcaagatcagctgcaagaa |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10367172 |
gtcgatatttttctctctgattttggatcacattcctttgaacacacttccttgtaactattgtttgtttgttcctttactacaagatcagctgcaagaa |
10367073 |
T |
 |
| Q |
230 |
gaagatgatgatgaattgaggtaatgtttatgtttgtatttttgtttgaggttgtggttgggaaatgaggagacaaacatat |
311 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||| ||||||| | | |||||||||||||||||||||||||||||| |
|
|
| T |
10367072 |
gaagaagatgatgaattgaggtaaagtttatgtttgtatgtttgttt-aagctgtggttgggaaatgaggagacaaacatat |
10366992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 348 - 458
Target Start/End: Complemental strand, 10366971 - 10366869
Alignment:
| Q |
348 |
atttttggaatgaatgaatgaagactcaaataagg-aaagggtatattttctataaaaagttgactaggcccacttaggtcatcttttttctccttttgt |
446 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| || || ||||||| |||| ||||||||||||||||| |
|
|
| T |
10366971 |
atttttggaatgaatgaatgaagactcaaataaggaaaagggtatattttctat---------acatggaccacttatgtcaccttttttctccttttgt |
10366881 |
T |
 |
| Q |
447 |
tgatatttcatg |
458 |
Q |
| |
|
||||||| |||| |
|
|
| T |
10366880 |
tgatattacatg |
10366869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 10367284 - 10367240
Alignment:
| Q |
18 |
tgttgaactcaccaaacaatccaaaaacagaaactgaatatggac |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10367284 |
tgttgaactcaccaaacaatccaaaaacagaaactgaataaggac |
10367240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University