View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9011_low_64 (Length: 433)
Name: NF9011_low_64
Description: NF9011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9011_low_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 2e-43; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 50650939 - 50651036
Alignment:
| Q |
1 |
atttttaaaccacaaatttataagtagaaatcaaacttgataaatttataagtttataacgcacaaagtaaccactcgtgcttgatgaggcaataaac |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50650939 |
atttttaaaccacaaatttataagtagaaatcaaacttaataaatttataagtttataacgcacaaagtaaccacttgtgcttgatgaggcaataaac |
50651036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 319 - 405
Target Start/End: Original strand, 50651257 - 50651343
Alignment:
| Q |
319 |
aaaatcacactcggatatattgcaattgccattttggttgaacgggttgaagcatagttggctcaacaaatatttatttttatttcc |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50651257 |
aaaatcacactcggatatattgcaattgccattttggttgaacgggttgaagcatagttggctcaacaaatatttatttttatttcc |
50651343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 187 - 268
Target Start/End: Original strand, 50651125 - 50651206
Alignment:
| Q |
187 |
ggatactttaagaataattgtaatttatgtgcaatgnnnnnnngacatagacaattgttttaacgcttagataatacaagca |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50651125 |
ggatactttaagaataattgtaatttatgtgcaatgtttttttgacatagacaattgttttaacgctcagataatacaagca |
50651206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University