View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9011_low_75 (Length: 409)
Name: NF9011_low_75
Description: NF9011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9011_low_75 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 20 - 282
Target Start/End: Original strand, 50651352 - 50651615
Alignment:
| Q |
20 |
ataatatttggcattgattgagaagataattctgtcaaatcccagctcaatactccacaaaaatgcatctaacaaagcttttgcttctcccattcggact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50651352 |
ataatatttggcattgattgagaagataattctgtcaaatcccagctcaatactccacaaaaatgcatctaacaaagcttttgcttctcccattcggact |
50651451 |
T |
 |
| Q |
120 |
gacatcaaaggttccaaccatagagtgttcactccgacaaacaaatcatctcgtccctaatacatattccaataccaactcattatgatgagag-agaaa |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
50651452 |
gacatcaaaggttccagccatagagtgttcactccgacaaacaaatcatctcgtccctaatacatattccaataccaactcattatgatgagagaaaaaa |
50651551 |
T |
 |
| Q |
219 |
aatgctggtagtacgacaccattgaatcaaactgctttgcttgagctgctacccttgggatcac |
282 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50651552 |
aatgctggtaggacgacaccattgaatcaaactgctttgcttgagctgctacccttgggatcac |
50651615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 322 - 409
Target Start/End: Original strand, 50651615 - 50651702
Alignment:
| Q |
322 |
cgctcgacctctacaaaccacatcagctgaactttcgactttattttcccaaattgtcaggttcctactcttccacaagctccacatc |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50651615 |
cgctcgacctctacaaaccacatcagctgaactttcgactttattttcccaaattgtcaggttcctactcttccacaagctccacatc |
50651702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University