View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9012_low_1 (Length: 371)
Name: NF9012_low_1
Description: NF9012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9012_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 224
Target Start/End: Complemental strand, 47713309 - 47713095
Alignment:
| Q |
10 |
tttggtgttagaaaattcgatcaagaacaatgggagtttaaaccccctttggttcaagttaaaccccctccggttaagaaaatccaaaaccccttttcgg |
109 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47713309 |
tttggtgtaagaaaattcgatcaagaacaatgggagtttaaaccccctttggttcaagttaaaccccctctggttaagaaaatccaaaaccccttttcgg |
47713210 |
T |
 |
| Q |
110 |
tacttcacgattataccgatgaagactctttgatgagtgaagagattgcggtgagggatgcggcgaaggctgcggcgagggctaagagagatgagaaaag |
209 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47713209 |
tacttcacgattatactgatgaagactctttgatgagtgaagagattgcggtgagggatgcggcgaaggctgcggcgagggccaagagagatgagaaaag |
47713110 |
T |
 |
| Q |
210 |
aaaagcttctctttt |
224 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47713109 |
aaaagcttctctttt |
47713095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 317 - 352
Target Start/End: Complemental strand, 47713002 - 47712967
Alignment:
| Q |
317 |
ttgtattggctaagaagcttgttgaacggtataatc |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47713002 |
ttgtattggctaagaagcttgttgaacggtataatc |
47712967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University