View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9012_low_10 (Length: 274)
Name: NF9012_low_10
Description: NF9012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9012_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 26 - 258
Target Start/End: Original strand, 36203338 - 36203570
Alignment:
| Q |
26 |
gatgtaggcgtagtttgaggaagaagctgcaatatgtagcttcttaaaaatatggtgaaatcaacatggggatgcgatattgttcaattaaacgtataat |
125 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||| |||||||||||||||||||||| || |||||||||||||||| |||||||||||| ||||| |
|
|
| T |
36203338 |
gatgtaggcgtggtttgaggaagaagctacaatatgtaacttcttaaaaatatggtgaaattaatatggggatgcgatattcttcaattaaacgcataat |
36203437 |
T |
 |
| Q |
126 |
caaccaactacttagtgtggtgggaaaataaaagagaaatatcaatatttgaagccgggagaatatgaatttaacattacgagtatttgaatgattcaca |
225 |
Q |
| |
|
||| |||||| |||||||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36203438 |
caaacaactatttagtgtggtggaaaaataaaagagaaacgtcaatatttgaagccgaaagaatatgaatttaacattatgagtatttgaatgattcaca |
36203537 |
T |
 |
| Q |
226 |
taattaaacatgcattatgtttaggttgataat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36203538 |
taattaaacatgcattatgtttaggttgataat |
36203570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University