View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9012_low_2 (Length: 371)

Name: NF9012_low_2
Description: NF9012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9012_low_2
NF9012_low_2
[»] chr3 (2 HSPs)
chr3 (10-224)||(47713095-47713309)
chr3 (317-352)||(47712967-47713002)


Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 224
Target Start/End: Complemental strand, 47713309 - 47713095
Alignment:
10 tttggtgttagaaaattcgatcaagaacaatgggagtttaaaccccctttggttcaagttaaaccccctccggttaagaaaatccaaaaccccttttcgg 109  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
47713309 tttggtgtaagaaaattcgatcaagaacaatgggagtttaaaccccctttggttcaagttaaaccccctctggttaagaaaatccaaaaccccttttcgg 47713210  T
110 tacttcacgattataccgatgaagactctttgatgagtgaagagattgcggtgagggatgcggcgaaggctgcggcgagggctaagagagatgagaaaag 209  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
47713209 tacttcacgattatactgatgaagactctttgatgagtgaagagattgcggtgagggatgcggcgaaggctgcggcgagggccaagagagatgagaaaag 47713110  T
210 aaaagcttctctttt 224  Q
    |||||||||||||||    
47713109 aaaagcttctctttt 47713095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 317 - 352
Target Start/End: Complemental strand, 47713002 - 47712967
Alignment:
317 ttgtattggctaagaagcttgttgaacggtataatc 352  Q
    ||||||||||||||||||||||||||||||||||||    
47713002 ttgtattggctaagaagcttgttgaacggtataatc 47712967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University