View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9012_low_8 (Length: 326)
Name: NF9012_low_8
Description: NF9012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9012_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 295; Significance: 1e-166; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 9084910 - 9084604
Alignment:
| Q |
1 |
aacgatatgaagtagcaaatcaatagatgagatgaaactatgattagtggtgtttgaaggctcacaaaaaccctagcccttatcaaaattgtggttgcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9084910 |
aacgatatgaagtagcaaatcaatagatgagatgaaactatgattagtggtgtttgaaggctcacaagaaccctagcccttatcaaaattgtggttgcca |
9084811 |
T |
 |
| Q |
101 |
aagagagatcaagaagtccttgatttttgtgagatgttcctttaaattatgaaatcagcgaattttatattcgtaactcgtagctttgtgtatgcaagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9084810 |
aagagagatcaagaagtccttgatttttgtgagatgttcctttaaattatgaaatcagcgaattttatattcataactcgtagctttgtgtatgcaagat |
9084711 |
T |
 |
| Q |
201 |
tcccttttccaatagttacattcaaacatcgtgggatgctggtatatttccttaaacccttgcattctgctgagaattcgccttttcctgcagctattta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9084710 |
tcccttttccaatagttacattcaaacatcgtgggatgctggtatatttccttaaacccttgcattctgctgagaattcaccttttcctgcagctattta |
9084611 |
T |
 |
| Q |
301 |
agaacca |
307 |
Q |
| |
|
||||||| |
|
|
| T |
9084610 |
agaacca |
9084604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 220 - 270
Target Start/End: Complemental strand, 9079612 - 9079562
Alignment:
| Q |
220 |
attcaaacatcgtgggatgctggtatatttccttaaacccttgcattctgc |
270 |
Q |
| |
|
|||||| |||||||||||||| | | ||||||||||||||||||| ||||| |
|
|
| T |
9079612 |
attcaagcatcgtgggatgctagaaaatttccttaaacccttgcaatctgc |
9079562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University