View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9012_low_9 (Length: 285)
Name: NF9012_low_9
Description: NF9012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9012_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 3416177 - 3415906
Alignment:
| Q |
1 |
gtcctcataaatataagtatagttaattactatatatattttttctttctatcccattagggcatggcttgtgtttaactttagtgaattgtacctttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3416177 |
gtcctcataaatataagtatagttaattactatattttttttttctttctatcccattagggcatggcttgtgtttaactttagtgaattgtacctttct |
3416078 |
T |
|
| Q |
101 |
tgaccttgatcgatttttgactagataaataaacaaattaaagtttacatctatgtcggaagaacttcttaataatgctcaaatatccaggcagctcata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3416077 |
tgaccttgatcgatttttgactagataaataaacaaattaaagtttacatctatgtcggaaaaacttcttaataatgctcaaatatccaggcagctcata |
3415978 |
T |
|
| Q |
201 |
tgaataatttcatataggtggatttgatgaatccctacattgatcacgttccatgggaccatatgaacacca |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3415977 |
tgaataatttcatataggtggatttgatgaatccctacattgatcacgttccatgggaccatatgaacacca |
3415906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University