View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9013_low_6 (Length: 540)
Name: NF9013_low_6
Description: NF9013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9013_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 8 - 275
Target Start/End: Original strand, 32641963 - 32642227
Alignment:
| Q |
8 |
atggtggtgatggttgatggtcaggagtattattctgggccgtggccgtggtcgtggtggtggaggtgatgtttgacattgtggatgatgatgatgatac |
107 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32641963 |
atggtggtgattgttgatggtcagaagtattattctgggtcgtggccgtggtcgtggtggtggaggtgatgtttgacattgtggatg---atgatgatac |
32642059 |
T |
|
| Q |
108 |
cctttgttgaggaaaatatggccaattttgaggtatggtacttggtattttaggaggtaactgtgccattaatcccaatgagtatgtgtgaccccaaata |
207 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32642060 |
cctttggtgaggaaaatatggccaattttggggtatggtacttggtattttaggaggtaactgtgccattaatcccaatgagtatgtgtgaccccaaata |
32642159 |
T |
|
| Q |
208 |
tagaggaagtttaaccgaaatttttggtattgtgttgtgttatgtatcttataagtgtttgtgttttt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32642160 |
tagaggaagtttaaccgaaatttttggtattgtgttgtgttatgtatcttataagtgtttgtgttttt |
32642227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 310 - 388
Target Start/End: Original strand, 32642262 - 32642340
Alignment:
| Q |
310 |
tctcaacaacctaaccaacacacaaacaaccgcaaatctttacttcaaaatcttgttctcgggcttctaaaagtagtgg |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32642262 |
tctcaacaacctaaccaacacacaaacaaccgcaaatctttacttcaaaatcttgttctcgggcttctaaaagtagtgg |
32642340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 436 - 512
Target Start/End: Original strand, 32642384 - 32642460
Alignment:
| Q |
436 |
gcaataacacctgcaccatattgtgtcatgtacaatacacaattatgatgatgatatgtttttctttaccctctata |
512 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32642384 |
gcaataacacctgcaccatattgtgtcatgtacaatacacaattatgatgatgatatgtttttctttaccctctata |
32642460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University