View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9014_low_7 (Length: 202)
Name: NF9014_low_7
Description: NF9014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9014_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 7e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 61 - 179
Target Start/End: Original strand, 36000629 - 36000751
Alignment:
| Q |
61 |
aaataaattaggaatag----ggtgaagattcttaccgatttgaaacattcatgcaaatatctattattcaagtcctcttcctctttgttgggggaataa |
156 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36000629 |
aaataaattaggaatagctagggtgaagattcttaccgatttgaaacattcatgcaaatatctattattcaagtcctcttcctctttgttaggggaataa |
36000728 |
T |
|
| Q |
157 |
attgttattgttggtcatctcgc |
179 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36000729 |
attgttattgttggtcatctcgc |
36000751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 76 - 134
Target Start/End: Original strand, 36021803 - 36021861
Alignment:
| Q |
76 |
agggtgaagattcttaccgatttgaaacattcatgcaaatatctattattcaagtcctc |
134 |
Q |
| |
|
||||||||||| | ||||||||| ||| |||||||||| || |||||||||||||||| |
|
|
| T |
36021803 |
agggtgaagatccataccgattttgaacgttcatgcaaagatttattattcaagtcctc |
36021861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University