View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9015_high_25 (Length: 235)
Name: NF9015_high_25
Description: NF9015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9015_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 26 - 215
Target Start/End: Complemental strand, 30504651 - 30504462
Alignment:
| Q |
26 |
atttatagagattaaaaataaatagtaataatgtaatgataaatgtttattggcaaaccaagttttaattaaggaacctgatcttggcttttgatatgat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
30504651 |
atttatagagattaaaaataaatagtaataatgtaatgataaatctttattggcaaaccaagttttaaataaggaacctgatcttggcctttgatatgat |
30504552 |
T |
 |
| Q |
126 |
gaccacatgtgagacaagttctaattaagctgtcctttctttcatccactgtgatgatatgattgttttggggatcactgcactgagtca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| || |||||||||||||||| |
|
|
| T |
30504551 |
gaccacatgtgagacaagttctaattaagctgtcctttcttccatccactgtgatgaccacattgttttgagggtcactgcactgagtca |
30504462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 99 - 156
Target Start/End: Complemental strand, 38886323 - 38886266
Alignment:
| Q |
99 |
gaacctgatcttggcttttgatatgatgaccacatgtgagacaagttctaattaagct |
156 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
38886323 |
gaacctgatcttggcatttgatatgatgaccacatgtaggacaagttctgattaagct |
38886266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University