View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9015_low_44 (Length: 283)
Name: NF9015_low_44
Description: NF9015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9015_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 92 - 266
Target Start/End: Original strand, 39269457 - 39269629
Alignment:
| Q |
92 |
attgaaattgacttcgaaataaaagtaatttgggttttttaatttcataattgtcttacatagaaaaaatgtttaaattcttctaccnnnnnnngtatag |
191 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
39269457 |
attgaaattgacttcgaaataagagtaatttgggttttttaatttcataattgtcttacatagaaaaaatgtttaaattcttgta--aaaaaaagtatag |
39269554 |
T |
 |
| Q |
192 |
ttgaccatgagcaccttggtgtgccgcacacttgtgtggtgcacttgttgtgttaaagttatcgaaggagcttgg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39269555 |
ttgaccatgagcaccttggtgtgccgcacgcttgtgtggtgcacttgttgtgttaaagttatcgaaggagcttgg |
39269629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 62
Target Start/End: Original strand, 39269391 - 39269429
Alignment:
| Q |
24 |
gtactattgttgtctctatctacacctttttcactcaat |
62 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
39269391 |
gtactactattgtctctatctacacctttttcactcaat |
39269429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University