View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9015_low_54 (Length: 240)
Name: NF9015_low_54
Description: NF9015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9015_low_54 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 9e-51; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 6 - 126
Target Start/End: Original strand, 23263025 - 23263148
Alignment:
| Q |
6 |
tataacaaggttttggttgagagggacaattatgccttctag---gtgggaattgtgtttgataaacatcctttatatttttaacaattgcaaaatcatt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23263025 |
tataacaaggttttggttgagagggacaattatgccttctataatgtgggaattgtgtttgataaacatcctttatatttttaacaattgcaaagtcatt |
23263124 |
T |
 |
| Q |
103 |
gggcactctatttagcaatccaag |
126 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
23263125 |
gggcactctatttagcaatccaag |
23263148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 129 - 223
Target Start/End: Original strand, 23264593 - 23264686
Alignment:
| Q |
129 |
ttactagatctcaattatgttgtagtgnnnnnnnnaagtatattattaatgggaaagttttactcccacgccaaacttcttcgttaacgagtatc |
223 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |||||||||||| | || ||||||| |
|
|
| T |
23264593 |
ttactagatctcaattatgttgtagtgttttttt-aagtatattattattgggaaagttttactcccacaccaaacttcttcatcaaggagtatc |
23264686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 151
Target Start/End: Original strand, 23904441 - 23904469
Alignment:
| Q |
123 |
caagtgttactagatctcaattatgttgt |
151 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23904441 |
caagtgttactagatctcaattatgttgt |
23904469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Original strand, 26619191 - 26619223
Alignment:
| Q |
123 |
caagtgttactagatctcaattatgttgtagtg |
155 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
26619191 |
caagtgttactagatgtcaattatgttgtagtg |
26619223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Complemental strand, 30786278 - 30786246
Alignment:
| Q |
123 |
caagtgttactagatctcaattatgttgtagtg |
155 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
30786278 |
caagtgttactagatcttaattatgttgtagtg |
30786246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Complemental strand, 31571040 - 31571008
Alignment:
| Q |
123 |
caagtgttactagatctcaattatgttgtagtg |
155 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
31571040 |
caagtgttactagatgtcaattatgttgtagtg |
31571008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 155
Target Start/End: Complemental strand, 42076074 - 42076046
Alignment:
| Q |
127 |
tgttactagatctcaattatgttgtagtg |
155 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42076074 |
tgttactagatctcaattatgttgtagtg |
42076046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Original strand, 9633531 - 9633563
Alignment:
| Q |
123 |
caagtgttactagatctcaattatgttgtagtg |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
9633531 |
caagtgttactaaatctcaattatgttgtagtg |
9633563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University