View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9015_low_65 (Length: 206)
Name: NF9015_low_65
Description: NF9015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9015_low_65 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 13 - 150
Target Start/End: Complemental strand, 38834160 - 38834023
Alignment:
| Q |
13 |
ttctaaaattgatctgacataaagcagtctacagcaaaaaacaaattctaaagactgttctgtccttttttatgtataacaaaaatgtatgattttgata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38834160 |
ttctaaaattgatctgacataaagcagtctacagcaaaaaacaaattctaaagactgtcctgtccttttttatgtataacaaaaatgcatgattttgata |
38834061 |
T |
|
| Q |
113 |
cattttctgtcatcatcagtcatattttgtctcacata |
150 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38834060 |
caatttctgtcatcatcagtcatattttgtctcacata |
38834023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 194
Target Start/End: Complemental strand, 38833516 - 38833471
Alignment:
| Q |
149 |
tatttgttttgtggcaatatgcaaaattgaattgttaattagtctc |
194 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
38833516 |
tatttgttttgtggctttatgcaaaattgaattgtttattagtctc |
38833471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University