View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9015_low_66 (Length: 206)

Name: NF9015_low_66
Description: NF9015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9015_low_66
NF9015_low_66
[»] chr3 (2 HSPs)
chr3 (13-150)||(38834023-38834160)
chr3 (149-194)||(38833471-38833516)


Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 13 - 150
Target Start/End: Complemental strand, 38834160 - 38834023
Alignment:
13 ttctaaaattgatctgacataaagcagtctacagcaaaaaacaaattctaaagactgttctgtccttttttatgtataacaaaaatgtatgattttgata 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||    
38834160 ttctaaaattgatctgacataaagcagtctacagcaaaaaacaaattctaaagactgtcctgtccttttttatgtataacaaaaatgcatgattttgata 38834061  T
113 cattttctgtcatcatcagtcatattttgtctcacata 150  Q
    || |||||||||||||||||||||||||||||||||||    
38834060 caatttctgtcatcatcagtcatattttgtctcacata 38834023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 194
Target Start/End: Complemental strand, 38833516 - 38833471
Alignment:
149 tatttgttttgtggcaatatgcaaaattgaattgttaattagtctc 194  Q
    |||||||||||||||  ||||||||||||||||||| |||||||||    
38833516 tatttgttttgtggctttatgcaaaattgaattgtttattagtctc 38833471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University