View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9016_low_1 (Length: 1084)
Name: NF9016_low_1
Description: NF9016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9016_low_1 |
 |  |
|
| [»] scaffold0121 (3 HSPs) |
 |  |  |
|
| [»] scaffold1185 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |  |
|
| [»] scaffold0088 (2 HSPs) |
 |  |  |
|
| [»] scaffold0009 (3 HSPs) |
 |  |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |  |
|
| [»] scaffold0445 (2 HSPs) |
 |  |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
| [»] scaffold0460 (2 HSPs) |
 |  |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (2 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
| [»] scaffold1372 (1 HSPs) |
 |  |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (2 HSPs) |
 |  |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |  |
|
| [»] scaffold0864 (2 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold1709 (1 HSPs) |
 |  |  |
|
| [»] scaffold1331 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0517 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (2 HSPs) |
 |  |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |  |
|
| [»] scaffold0004 (2 HSPs) |
 |  |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0394 (1 HSPs) |
 |  |  |
|
| [»] scaffold0330 (1 HSPs) |
 |  |  |
|
| [»] scaffold0294 (2 HSPs) |
 |  |  |
|
| [»] scaffold0276 (1 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0117 (1 HSPs) |
 |  |  |
|
| [»] scaffold0116 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0199 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (2 HSPs) |
 |  |  |
|
| [»] scaffold0034 (1 HSPs) |
 |  |  |
|
| [»] scaffold0068 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 316; Significance: 1e-178; HSPs: 169)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 137 - 535
Target Start/End: Complemental strand, 14191080 - 14190684
Alignment:
| Q |
137 |
tttgatgctagttggctgttatgcacatgattgatatacatatataatgactgttatctgttttccgctttccccaaccttccctcttacaggttcactg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14191080 |
tttgatgctagttggctgttatgcacatgattgatatacatatataatgactgttatctgttttccgctttccccaaccttccctcttacaggttcactg |
14190981 |
T |
 |
| Q |
237 |
gacagtgaagctggtatttatgctttaacctatgatgtcacgggcacgaggcttatatcatctgaagcagacaagaccataaaaatgtggaaaga---tg |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
14190980 |
gacagtgaagctggtatttatgctttaacctatgatgtcacgggcacgaggcttatatcatgtgaagcagacaagaccataaaaatgtggaaagaagatg |
14190881 |
T |
 |
| Q |
334 |
acaatgccactccagaaacacatcccctcaacttcaggcctcctaaagacatccgtcgattctagttacgcagtcctattttattccgtcgtgtaataca |
433 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||||| || |
|
|
| T |
14190880 |
acaatgccactccagaaacacatcccctcaacttcaggcctcctaaagacatccgtcgattctagttacgcggtcctatt-----cggtcgtgtaatgca |
14190786 |
T |
 |
| Q |
434 |
cattttgattagatgtgctgttacttggaggtcttgatgtacaattatgtattcaaacttctctttttaacacacttttctcatcctgtttgtaccactg |
533 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| || ||| |||||||||| ||||| |||||||||||| | ||||||||| || |
|
|
| T |
14190785 |
cattttgattagatgttctgttacttggaggtcttgatgtacaattatttagtcacacttctctttgtaacatacttttctcatcttttttgtaccattg |
14190686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 171; E-Value: 3e-91
Query Start/End: Original strand, 568 - 773
Target Start/End: Original strand, 14187993 - 14188197
Alignment:
| Q |
568 |
tgtatttcattagctttgcaatttggtttagtgtataaaatacagaacccacaaaacacaagcataaagaaaaaagaaagaattctgtcagtcatgtatg |
667 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |||| |
|
|
| T |
14187993 |
tgtatttcattagctttgcaatttggtttagtgtataaaatacagaacccacaaaacacaagcaaaaagaaaaaagaaagaattttgtcagtc---tatg |
14188089 |
T |
 |
| Q |
668 |
cttttgtgacattgtttgtctaattttctgtgtatccgttcattcaagcaaggtttttggtgtagtttaagggttaggcaggaaact--tagtctaaaat |
765 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14188090 |
cttttgtgacattgtttgtctaattttctgtgtatccgttcattcaagcaaagtttttggtgtagtttaagggttaggcaggaaacttatagtctaaaat |
14188189 |
T |
 |
| Q |
766 |
gtgactac |
773 |
Q |
| |
|
|||||||| |
|
|
| T |
14188190 |
gtgactac |
14188197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 160; E-Value: 1e-84
Query Start/End: Original strand, 855 - 1046
Target Start/End: Original strand, 14188279 - 14188470
Alignment:
| Q |
855 |
tcatttatttgttatgaatataacaagtggatgtccataaacccttgtatttatctcttaagtgacaacatattacttttcttttaagtcacacctattt |
954 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14188279 |
tcatttatttgttatgaatataataagtggatgtccagaaacccttgtatttatctgttaagtgacaacatattacttttcttttaagtcacatctattt |
14188378 |
T |
 |
| Q |
955 |
gtatttattcttacttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaata |
1046 |
Q |
| |
|
||| |||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14188379 |
gtacttatccttacttaacttttgagtcatatcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaata |
14188470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 120; E-Value: 8e-61
Query Start/End: Original strand, 221 - 471
Target Start/End: Complemental strand, 6337174 - 6336921
Alignment:
| Q |
221 |
tcttacaggttcactggacagtgaagctggtatttatgctttaacctatgatgtcacgggcacgaggcttatatcatctgaagcagacaagaccataaaa |
320 |
Q |
| |
|
||||||||||||| |||||| ||| |||| ||||||||||||||| |||||||||||||| |||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
6337174 |
tcttacaggttcaatggacaatgaggctgctatttatgctttaacgtatgatgtcacgggtacgaggcttatatcatgtgaagctgacaagaccataaaa |
6337075 |
T |
 |
| Q |
321 |
atgtgga---aagatgacaatgccactccagaaacacatcccctcaacttcaggcctcctaaagacatccgtcgattctagttacgcagtcctattttat |
417 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||| || ||||||| |||||||| |||| ||| ||||| |||||||| || | ||||| |
|
|
| T |
6337074 |
atgtggaaagaagatgacactgccactccagaaacacatccacttaacttcatacctcctaataacattcgttgattcgagttacgcgatcgtcatttat |
6336975 |
T |
 |
| Q |
418 |
tccgtcgtgtaatacacattttgattagatgtgctgttacttggaggtcttgat |
471 |
Q |
| |
|
|| | | |||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
6336974 |
tctgacaagtaatacacattttgattagatgtattgttacttggaggtgttgat |
6336921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 41 - 98
Target Start/End: Complemental strand, 6636042 - 6635985
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagggacgg |
98 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6636042 |
atatctctgtgagcttagctcagttggtagggatattgcatattatatgcagggacgg |
6635985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 42 - 96
Target Start/End: Original strand, 44948592 - 44948646
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44948592 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagggac |
44948646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 8250376 - 8250323
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8250376 |
atatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
8250323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 40 - 93
Target Start/End: Complemental strand, 25857371 - 25857318
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25857371 |
gatatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
25857318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 41 - 93
Target Start/End: Original strand, 18694780 - 18694832
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18694780 |
atatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
18694832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 22653719 - 22653667
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22653719 |
atatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
22653667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 33229007 - 33228955
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33229007 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
33228955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 3287129 - 3287078
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3287129 |
atccctgtgagcttagctcagttggaagggatattgcatattatatgcaggg |
3287078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 3446726 - 3446777
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3446726 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
3446777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 19281604 - 19281655
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19281604 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
19281655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 38400307 - 38400358
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38400307 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
38400358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 4183173 - 4183223
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4183173 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
4183223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 19684070 - 19684120
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19684070 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
19684120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 2289605 - 2289658
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2289605 |
atatccccgtgagcttagctcagttggtaggaatattgcatattatatgcaggg |
2289658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 15764933 - 15764978
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15764933 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
15764978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 34613982 - 34614027
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34613982 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
34614027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 40535524 - 40535471
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40535524 |
atatccccgtgagcttagctcagttggtacggatattgcatattatatgcaggg |
40535471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 44857301 - 44857256
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44857301 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
44857256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 5521294 - 5521242
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5521294 |
tatccccgtgagcttagctcagttgatagggatattgcatattatatgcaggg |
5521242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 11050831 - 11050779
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11050831 |
tatccccgtgagcttagctcagttggtagggatattacatattatatgcaggg |
11050779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 36182645 - 36182689
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36182645 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
36182689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 38179319 - 38179267
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38179319 |
tatccctgtgagtttagctcagttggtagggatattgcattttatatgcaggg |
38179267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 41509519 - 41509563
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41509519 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
41509563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 1844814 - 1844865
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1844814 |
atccccgtaagcttagctcagttggtagggatattgcatattatatgcaggg |
1844865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 2643693 - 2643744
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2643693 |
tatccccgtgagcatagctcagttggtagggatattgcatattatatgcagg |
2643744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 3438944 - 3438995
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3438944 |
tatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
3438995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 4562826 - 4562775
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4562826 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatgcagg |
4562775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 6331558 - 6331609
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6331558 |
tatccccgtgagcatagctcagttggtagggatattgcatattatatgcagg |
6331609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 15233410 - 15233461
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15233410 |
atccccgtgagcttagctcaattggtagggatattgcatattatatgcaggg |
15233461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 17034731 - 17034782
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17034731 |
tatccccgtgagcttagctcaattggtagggatattgcatattatatgcagg |
17034782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 17078453 - 17078504
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17078453 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatgcagg |
17078504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 30932520 - 30932469
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30932520 |
tatccccgtgagcttacctcagttggtagggatattgcatattatatgcagg |
30932469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 45 - 91
Target Start/End: Original strand, 5612953 - 5612999
Alignment:
| Q |
45 |
ccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5612953 |
ccctgtgagcttagctcagttggcagggatattgcatattatatgca |
5612999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 7910030 - 7909956
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
7910030 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcatcttt |
7909956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 18278490 - 18278440
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18278490 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcagg |
18278440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 27297172 - 27297222
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27297172 |
atccccgtgagcttagctcagttggtagggatattgcatattgtatgcagg |
27297222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 28195201 - 28195159
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28195201 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
28195159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 33233295 - 33233245
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33233295 |
atccccgtgagcttatctcagttggtagggatattgcatattatatgcagg |
33233245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 41566760 - 41566810
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41566760 |
tccccgtgagcttagctcagttggtaggaatattgcatattatatgcaggg |
41566810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 43777083 - 43777157
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
43777083 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcatcttt |
43777157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 41 - 90
Target Start/End: Original strand, 15485657 - 15485706
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15485657 |
atatccccgtgagcttagctcagttggtaaggatattgcatattatatgc |
15485706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 27913536 - 27913491
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27913536 |
gtgagcttagctcaattggtagggatattgcatattatatgcaggg |
27913491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 42 - 91
Target Start/End: Complemental strand, 39408764 - 39408715
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39408764 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatgca |
39408715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 41 - 93
Target Start/End: Original strand, 1071465 - 1071517
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
1071465 |
atatccccgtgagcttagctcagttggtatggatattgtatattatatgcagg |
1071517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 28194636 - 28194680
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28194636 |
tgagcttagctcagttgctagggatattgcatattatatgcaggg |
28194680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 31223624 - 31223668
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31223624 |
tgagcttagttcagttggtagggatattgcatattatatgcaggg |
31223668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 46 - 136
Target Start/End: Original strand, 40931136 - 40931232
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatgcagggac-ggac-----accccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||| |||| |||| || |||||||||||||||||| |||||| ||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40931136 |
cctgtgagcttaactcatttggcagagatattgcatattatatgtagggaccggagtttgaaccccacttctccacaatttaattgtgtgagctcta |
40931232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 55 - 94
Target Start/End: Original strand, 1500970 - 1501009
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1500970 |
ttagctcagttggtagggatattgcatattatatgcaggg |
1501009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 5474902 - 5474953
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
5474902 |
tatccccgtgagcttagctcagttggcagggatattgcatattatacgcagg |
5474953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 985 - 1060
Target Start/End: Original strand, 14898874 - 14898949
Alignment:
| Q |
985 |
atcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
||||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
14898874 |
atcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcctcttt |
14898949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 17487707 - 17487750
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17487707 |
gtgaacttagctcagttggtagggatattgcatattatatgcag |
17487750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 28153216 - 28153165
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28153216 |
tatcccagtgagcttaactcagttggtagggatattgcatgttatatgcagg |
28153165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 50 - 89
Target Start/End: Complemental strand, 30392898 - 30392859
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30392898 |
tgagcttagctcagttggtagggatattgcatattatatg |
30392859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 38525626 - 38525575
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
38525626 |
atccccgtgagcttagctcagttggtaaggatattgcattttatatgcaggg |
38525575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 44822419 - 44822470
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
44822419 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
44822470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 41 - 91
Target Start/End: Complemental strand, 466681 - 466631
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
466681 |
atatccccgtgagcatagctcagttggtagggatattacatattatatgca |
466631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 630823 - 630897
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
630823 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcctcttt |
630897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 636374 - 636448
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
636374 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcctcttt |
636448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 89
Target Start/End: Original strand, 1260182 - 1260228
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1260182 |
atccccgtgagcttagctcagttggtagggatattgcatgttatatg |
1260228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 7917485 - 7917411
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
7917485 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcttcttt |
7917411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 14893322 - 14893396
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
14893322 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcctcttt |
14893396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 20296415 - 20296465
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
20296415 |
atccccgtgagcttagctcagttgataaggatattgcatattatatgcagg |
20296465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 22430440 - 22430514
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
22430440 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcctcttt |
22430514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 22436034 - 22436108
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
22436034 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcctcttt |
22436108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 23405194 - 23405244
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
23405194 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgcaggg |
23405244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 42 - 92
Target Start/End: Complemental strand, 29942200 - 29942150
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||| |||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
29942200 |
tatccatgtgagcttaactcagttagtagggatattgcatattatatgcag |
29942150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 55 - 93
Target Start/End: Complemental strand, 30390430 - 30390392
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30390430 |
ttagctcagttggtagggatattgcatattatatgcagg |
30390392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 47 - 89
Target Start/End: Original strand, 32168929 - 32168971
Alignment:
| Q |
47 |
ctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32168929 |
ctgtgagcttaactcagttggtagggatattgcatattatatg |
32168971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 32609254 - 32609212
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32609254 |
gtgagcttaactcagttggtagggatattgcatattatatgca |
32609212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 48 - 94
Target Start/End: Original strand, 37063522 - 37063568
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37063522 |
tgtgatcttacctcagttggtagggatattgcatattatatgcaggg |
37063568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 48 - 94
Target Start/End: Complemental strand, 37352561 - 37352515
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37352561 |
tgtgagtttaactcagttggtagggatattgcatattatatgcaggg |
37352515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 2806568 - 2806523
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
2806568 |
gtgagcttagctcagttggtagggatattgtatattatatgtaggg |
2806523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 43 - 88
Target Start/End: Original strand, 5062294 - 5062339
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5062294 |
atccccgtgagcttaactcagttggtagggatattgcatattatat |
5062339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 5398180 - 5398131
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
5398180 |
atccctgtgaacttagctcagttggtagggatattacattttatatgcag |
5398131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 57 - 94
Target Start/End: Complemental strand, 7281747 - 7281710
Alignment:
| Q |
57 |
agctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7281747 |
agctcagttggtagggatattgcatattatatgcaggg |
7281710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 7379673 - 7379624
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||| ||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
7379673 |
atccccgtgagcttaactcagttggtaaggatattgcatattatatgcag |
7379624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 91
Target Start/End: Original strand, 18803207 - 18803256
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||| |||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
18803207 |
tatccccgtgagcttagctcacttggtaggaatattgcatattatatgca |
18803256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 91
Target Start/End: Complemental strand, 27497602 - 27497553
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27497602 |
tatccccgtgagcatagctcagttggtagggatattgcatgttatatgca |
27497553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 91
Target Start/End: Complemental strand, 33041937 - 33041888
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||| ||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33041937 |
tatccccgtgagtttaactcagttggtagggatattgcatattatatgca |
33041888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 38557298 - 38557245
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||| |||| |||||||||||| |
|
|
| T |
38557298 |
atatccccgtgagcttaactcagttggtagggatatggcattttatatgcaggg |
38557245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 40363138 - 40363093
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40363138 |
gtgagcttaactcagttggtagggatattgcatattatatgtaggg |
40363093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 40864402 - 40864447
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
40864402 |
gtgagcttagctcagttggtaggaatattgcattttatatgcaggg |
40864447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 43936704 - 43936749
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
43936704 |
gtgagcttagctcagttggtagggatatcgcattttatatgcaggg |
43936749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 44658333 - 44658378
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
44658333 |
gtgagcttagctcagttagtaggaatattgcatattatatgcaggg |
44658378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 5613019 - 5613059
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5613019 |
cggacaccccacttctccacaatttaattgtgtgagctcta |
5613059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 89
Target Start/End: Original strand, 19612718 - 19612758
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19612718 |
gtgagcttagttcagttggtagggatattgcatattatatg |
19612758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 22589903 - 22589947
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
22589903 |
tgagcttatcttagttggtagggatattgcatattatatgcaggg |
22589947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 33669732 - 33669784
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||| ||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
33669732 |
tatccccgtgagcttaactcagttagtagggatattgcatattatatgtaggg |
33669784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 35798100 - 35798048
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||| |||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
35798100 |
tatccccgtgagcttaactcagttgttagagatattgcatattatatgcaggg |
35798048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 46 - 93
Target Start/End: Complemental strand, 5003706 - 5003659
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5003706 |
cctgtgagcttgactcagttggtagggatattgcattttatatgcagg |
5003659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 47 - 94
Target Start/End: Complemental strand, 23919546 - 23919499
Alignment:
| Q |
47 |
ctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||| |||| |
|
|
| T |
23919546 |
ctgtgagcttagctcagttggtagggacattgcataatatatggaggg |
23919499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 33549128 - 33549077
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||||||||||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
33549128 |
tatccccgtgagcttagctcagttgatagagatattgtatattatatgcagg |
33549077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 36005438 - 36005489
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||| || |||| |||||||||||||||||||||||||||||| |
|
|
| T |
36005438 |
tatccccgtgagcgtaactcaattggtagggatattgcatattatatgcagg |
36005489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 43771557 - 43771629
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| | ||| |||| ||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
43771557 |
tcattgtatttctctataaatagag--ctcatataacctaattatacatcacaagagaataatataatcatcttt |
43771629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 50 - 92
Target Start/End: Complemental strand, 16385108 - 16385066
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
16385108 |
tgagcttagctcagttggtatggatattgcattttatatgcag |
16385066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 22425070 - 22425144
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| |||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
22425070 |
tcattgtatttctctataaatagagctcatatgtaacccaattatacatcacaagagaataatataatcctcttt |
22425144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 22718134 - 22718084
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||| || |||||||||||||| |
|
|
| T |
22718134 |
atccccgtgagcttaactcagttggtagggatactgtatattatatgcagg |
22718084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 26694245 - 26694319
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| ||||||||||||| ||||| ||||| |
|
|
| T |
26694245 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataacataatcttcttt |
26694319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 26702341 - 26702415
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| ||||||||||||| ||||| ||||| |
|
|
| T |
26702341 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataacataatcttcttt |
26702415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 27449186 - 27449228
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27449186 |
gtgagcatagctcagttggtagggatattgcattttatatgca |
27449228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 52 - 94
Target Start/End: Original strand, 34355727 - 34355769
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34355727 |
agctcagctcagttggtagggatattgtatattatatgcaggg |
34355769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 60 - 94
Target Start/End: Original strand, 38387677 - 38387711
Alignment:
| Q |
60 |
tcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38387677 |
tcagttggtagggatattgcatattatatgcaggg |
38387711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 42 - 96
Target Start/End: Original strand, 43146348 - 43146402
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
|||||| ||||| ||| |||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
43146348 |
tatccccgtgagtttaactcagttggtagggatattgcataatttatgcagggac |
43146402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 3301814 - 3301859
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||| ||||| |
|
|
| T |
3301814 |
gtgagcttagctcatttggtagggatattgcattttatatacaggg |
3301859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 8742891 - 8742846
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||| |||| |
|
|
| T |
8742891 |
gtgagcttagctcagttggtagagatattacatattatatgtaggg |
8742846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 9330568 - 9330523
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
9330568 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggg |
9330523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 13606310 - 13606265
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13606310 |
gtgagcttagctcagttggtagggatattaagtattatatgcaggg |
13606265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 16040244 - 16040289
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||| ||||||| |
|
|
| T |
16040244 |
gtgagcttagttcagttggtagggatattgcatgttatttgcaggg |
16040289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 17601082 - 17601127
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17601082 |
gtgaacttaactcagttggtagggatattgcatatcatatgcaggg |
17601127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 27016280 - 27016325
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||| ||||| |
|
|
| T |
27016280 |
gtgagcttagttcagttggtatggatattgcatattatatacaggg |
27016325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 48 - 89
Target Start/End: Complemental strand, 33222222 - 33222181
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33222222 |
tgtgaacttaactcagttggtagggatattgcatattatatg |
33222181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 55 - 96
Target Start/End: Original strand, 39265687 - 39265728
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
39265687 |
ttagctcagttggtagcgatactgcatattatatgcagggac |
39265728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 40688706 - 40688661
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
40688706 |
gtgatcttagctcagttggtagagatattgcattttatatgcaggg |
40688661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 99 - 136
Target Start/End: Original strand, 41187327 - 41187364
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41187327 |
acaccccacttctccacaatttaattgtgtgagctcta |
41187364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 1844882 - 1844922
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
1844882 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
1844922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 8322810 - 8322854
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
8322810 |
tgagcttagttcagttggtaggggtattgcatattatatacaggg |
8322854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 13975191 - 13975231
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
13975191 |
cggacaccccatttcttcacaattaaattgtgtgagctcta |
13975231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 15069804 - 15069764
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
15069804 |
cggacactccacttcttcataatttaattgtgtgagctcta |
15069764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 27082324 - 27082368
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
27082324 |
tgagcttagctcagttagtagggatattatatattatatgcaggg |
27082368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 28153147 - 28153107
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
28153147 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
28153107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 28194697 - 28194737
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
28194697 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
28194737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 29449452 - 29449496
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
29449452 |
tgagcttagctcagttggtagggatatcacattttatatgcaggg |
29449496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 89
Target Start/End: Complemental strand, 29772345 - 29772305
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
29772345 |
gtgagcttaacacagttggtagggatattgcatattatatg |
29772305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 30390374 - 30390334
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
30390374 |
cggacaccctacttctccacaatttaattgtgtgagctcta |
30390334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 33228938 - 33228898
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
33228938 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
33228898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 33816490 - 33816438
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| || || ||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33816490 |
tatccccgtcagtttacctcagttggtagagatattgcatattatatgcaggg |
33816438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 40473555 - 40473515
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
40473555 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
40473515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 89
Target Start/End: Original strand, 41286134 - 41286174
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
41286134 |
gtgagcttggttcagttggtagggatattgcatattatatg |
41286174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 43 - 91
Target Start/End: Original strand, 43895910 - 43895958
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
43895910 |
atccccgtgagcttagctcagttggtagggatatcacattttatatgca |
43895958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 44186508 - 44186548
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
44186508 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
44186548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 44898549 - 44898505
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44898549 |
gtgaggttaactcagttggtaggaatattgcatattatatgcagg |
44898505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 89
Target Start/End: Complemental strand, 7907617 - 7907570
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||| |||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
7907617 |
tatccccgtgagcttagtttaattggtagggatattgcatattatatg |
7907570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 88
Target Start/End: Complemental strand, 10679450 - 10679404
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
10679450 |
atatccctctgagcttagctcagttggta-ggatattacatattatat |
10679404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 24581537 - 24581486
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| || |||||| ||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
24581537 |
atccccgtaagcttaactcagttggcagggatattgcataatatatgcaggg |
24581486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 136
Target Start/End: Original strand, 27082386 - 27082425
Alignment:
| Q |
97 |
ggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
27082386 |
ggacactccacttctccacaatttaattgtgtgagctcta |
27082425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 91
Target Start/End: Original strand, 27152352 - 27152395
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||| |||||||| |
|
|
| T |
27152352 |
tgtgagcttaactcagttggtagggataatgcataatatatgca |
27152395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 136
Target Start/End: Complemental strand, 28692489 - 28692450
Alignment:
| Q |
97 |
ggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
28692489 |
ggacactccacttctccacaatttaattgtgtgagctcta |
28692450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 89
Target Start/End: Original strand, 31156806 - 31156853
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||||||| | |||||||||||||||||||||| |||||| |||||| |
|
|
| T |
31156806 |
tatccctgttaacttagctcagttggtagggataatgcataatatatg |
31156853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 33262439 - 33262490
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||| ||||||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
33262439 |
atccccgtgagtttagctcagctggtagggatatcgcattttatatgcaggg |
33262490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 33563282 - 33563231
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||| |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
33563282 |
atccccgtgaacttaactcagttggtagggatattgtattttatatgcaggg |
33563231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 136
Target Start/End: Original strand, 38400380 - 38400419
Alignment:
| Q |
97 |
ggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
38400380 |
ggacaccccacttctccacaattaaattgtgtgagctcta |
38400419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 40473623 - 40473572
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| |||||||||||| ||||||||| |||||||||||| |
|
|
| T |
40473623 |
atccccgtgagcttaactcagttggtagaaatattgcatgttatatgcaggg |
40473572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 44021070 - 44021121
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||| ||||||||||||| ||||||||| |||||| |||| |
|
|
| T |
44021070 |
tatccccgtgagcttaactcagttggtaggaatattgcatgttatatacagg |
44021121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 48 - 94
Target Start/End: Original strand, 8702575 - 8702621
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
8702575 |
tgtgagtttagctcatctgatagggatattgcatattatatgcaggg |
8702621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 48 - 94
Target Start/End: Original strand, 8732231 - 8732277
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
8732231 |
tgtgagtttagctcatctgatagggatattgcatattatatgcaggg |
8732277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 95
Target Start/End: Complemental strand, 11144289 - 11144235
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
||||||| ||||| |||||||||||||||| |||||||||||||| || ||||| |
|
|
| T |
11144289 |
atatccccgtgagtttagctcagttggtagaaatattgcatattatgtgtaggga |
11144235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 82
Target Start/End: Original strand, 19958097 - 19958135
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcata |
82 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
19958097 |
tccccgtgagcttagctcagttggtagggacattgcata |
19958135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 20565136 - 20565094
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
20565136 |
gtgagcttagctcagttggtagggacaatgcataatatatgca |
20565094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 82
Target Start/End: Original strand, 20919608 - 20919646
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcata |
82 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
20919608 |
tccccgtgagcttagctcagttggtagggacattgcata |
20919646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 21438901 - 21438939
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
21438901 |
gacactccacttctccacaatttaattgtgtgagctcta |
21438939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 25932539 - 25932581
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
25932539 |
gtgaacttagctcagttggtagggatattgtatattaaatgca |
25932581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 35429674 - 35429624
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||||||||||||||||| || |||||||| | ||||||||| |
|
|
| T |
35429674 |
tccccgtgagcttagctcagttggtagagacattgcataatttatgcaggg |
35429624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 41566829 - 41566867
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
41566829 |
gacactccacttctccacaatttaattgtgtgagctcta |
41566867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 88
Target Start/End: Complemental strand, 42199947 - 42199909
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
42199947 |
tgagtttaactcagttggtagggatattgcatattatat |
42199909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 82
Target Start/End: Original strand, 43214354 - 43214392
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcata |
82 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
43214354 |
tccccgtgagcttaactcagttggtagggatattgcata |
43214392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 43 - 88
Target Start/End: Original strand, 8763379 - 8763424
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
||||| |||||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
8763379 |
atccccgtgagcttagctcaattcgtagggatattgcattttatat |
8763424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 60 - 93
Target Start/End: Original strand, 17089257 - 17089290
Alignment:
| Q |
60 |
tcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
17089257 |
tcagttggtaggaatattgcatattatatgcagg |
17089290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 57 - 98
Target Start/End: Original strand, 26307629 - 26307670
Alignment:
| Q |
57 |
agctcagttggtagggatattgcatattatatgcagggacgg |
98 |
Q |
| |
|
|||| ||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
26307629 |
agcttagttgataggaatattgcatattatatgcagggacgg |
26307670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 55 - 92
Target Start/End: Complemental strand, 27464192 - 27464155
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
27464192 |
ttagctcagttggtaggaatattgcatgttatatgcag |
27464155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 136
Target Start/End: Complemental strand, 30849774 - 30849737
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
30849774 |
acactccacttcttcacaattaaattgtgtgagctcta |
30849737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 136
Target Start/End: Complemental strand, 33041865 - 33041828
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
33041865 |
acaccctacttcttcacaattaaattgtgtgagctcta |
33041828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 34434461 - 34434416
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| || ||||| ||||||||||| ||||||||||||||| |
|
|
| T |
34434461 |
gtgagcttaacttagttgatagggatattgtatattatatgcaggg |
34434416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 50 - 87
Target Start/End: Complemental strand, 36143259 - 36143222
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattata |
87 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
36143259 |
tgagtttagctcagttggtcgggatattgcatattata |
36143222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 36748890 - 36748934
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
36748890 |
gtgagcttaactcagttggtagggacattgcatatta-atgcaggg |
36748934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 42039205 - 42039254
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||| |||||| |||||||||||| || ||||| |||||||||||||||| |
|
|
| T |
42039205 |
atccatgtgagtttagctcagttgatatggatagtgcatattatatgcag |
42039254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 99; Significance: 3e-48; HSPs: 226)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 3e-48
Query Start/End: Original strand, 864 - 1053
Target Start/End: Original strand, 53529692 - 53529886
Alignment:
| Q |
864 |
tgttatgaatataacaagtggatgtccataaacccttgtatttatctcttaagtgacaacatattacttttcttttaagtcacacctatttgtatttatt |
963 |
Q |
| |
|
||||||||||||| ||||| ||||||| |||||||||||||||||| |||||||||| |||||| ||| ||||||||||||||||||||||| |||| |
|
|
| T |
53529692 |
tgttatgaatatactaagtgaatgtccacaaacccttgtatttatcttttaagtgacaccatatttcttatcttttaagtcacacctatttgtgcttatc |
53529791 |
T |
 |
| Q |
964 |
ct-----tacttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaat |
1053 |
Q |
| |
|
|| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||| | ||||| |||||||| |||| |
|
|
| T |
53529792 |
ctttaagtacttaactcttaagtcatatcattgcacttctctataaatagagaccacatataacataacggtatatcacaatagaataatataat |
53529886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 4e-47
Query Start/End: Original strand, 859 - 1077
Target Start/End: Original strand, 39119439 - 39119657
Alignment:
| Q |
859 |
ttatttgttatgaatataacaagtggatgtccataaacccttgtatttatctcttaagtgacaacatattacttttcttttaagtcacacctatttgtat |
958 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||| |||||||||| || | |||||||||||||||| || |
|
|
| T |
39119439 |
ttatttgttatgaatataa---gtggatgtccacaaacccttgtatttatctctttagtgacgccatattacttatc-tctaagtcacacctatttatac |
39119534 |
T |
 |
| Q |
959 |
ttat-tct----tacttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaat |
1053 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||| |||||||| ||||| |||||||| |||| |
|
|
| T |
39119535 |
ttatctcttaagtacttaactcttaagtcatatcattatacttctctataaatagagatcacatataacat-attgtacatcacaacagaataatataat |
39119633 |
T |
 |
| Q |
1054 |
catctttgtttctctctgcttctc |
1077 |
Q |
| |
|
||||| | |||||| || |||||| |
|
|
| T |
39119634 |
catctatatttctcccttcttctc |
39119657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 39023171 - 39023223
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39023171 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
39023223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 48569250 - 48569198
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48569250 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
48569198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 49901478 - 49901530
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49901478 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
49901530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 8965091 - 8965142
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8965091 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
8965142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 24680159 - 24680108
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24680159 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
24680108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 26868345 - 26868396
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26868345 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
26868396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 26919542 - 26919491
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26919542 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
26919491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 37935858 - 37935909
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37935858 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
37935909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 43596891 - 43596942
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43596891 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
43596942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 46582630 - 46582681
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46582630 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
46582681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 46775104 - 46775053
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46775104 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
46775053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 3847678 - 3847728
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3847678 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
3847728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 6371111 - 6371161
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6371111 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
6371161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 43147457 - 43147407
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43147457 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
43147407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 43207666 - 43207716
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43207666 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
43207716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 46105532 - 46105582
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46105532 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
46105582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 55251424 - 55251374
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55251424 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
55251374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 22788741 - 22788696
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22788741 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
22788696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 30217602 - 30217647
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30217602 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
30217647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 43978011 - 43978056
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43978011 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
43978056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 45849042 - 45849095
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45849042 |
atatccccgtgagcttagctcagttggtagggatattgcatattttatgcaggg |
45849095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 55853183 - 55853130
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55853183 |
atatccccgtgagcttagctcagttggtagagatattgcatattatatgcaggg |
55853130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 11375963 - 11375911
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11375963 |
tatccccgtgagcttagctcagttgatagggatattgcatattatatgcaggg |
11375911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 22230501 - 22230457
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22230501 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
22230457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 55238573 - 55238521
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
55238573 |
tatccccgtgagcttagcttagttggtagggatattgcatattatatgcaggg |
55238521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 3036128 - 3036077
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3036128 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggg |
3036077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 3764081 - 3764030
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3764081 |
atccccgtgagcttagctcagttggtagggatattacatattatatgcaggg |
3764030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 4234359 - 4234308
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4234359 |
tatccccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
4234308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 12167690 - 12167639
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167690 |
tatccctgtgaacttaactcagttggtagggatattgcatattatatgcagg |
12167639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 23787413 - 23787362
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23787413 |
tatccctgtgagcataactcagttggtagggatattgcatattatatgcagg |
23787362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 25235870 - 25235819
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25235870 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgcaggg |
25235819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 34353782 - 34353825
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34353782 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
34353825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 40051619 - 40051670
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40051619 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgtaggg |
40051670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 44602482 - 44602533
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44602482 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgcaggg |
44602533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 45126128 - 45126179
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45126128 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatgcagg |
45126179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 47934145 - 47934094
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47934145 |
atccccgtgagcttagctcagttggtagggatatggcatattatatgcaggg |
47934094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 41 - 92
Target Start/End: Original strand, 52798273 - 52798324
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52798273 |
atatccccgtgagcttaactcagttggtagggatattgcatattatatgcag |
52798324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 4958629 - 4958579
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4958629 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcagg |
4958579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 6162340 - 6162414
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
6162340 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcatcttt |
6162414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 8433696 - 8433646
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8433696 |
atccccgtgagcttagctcagttggtagggatattgcatattatatccagg |
8433646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 9761112 - 9761162
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9761112 |
atccccgtgagcttacctcagttggtagggatattgcatattatatgcagg |
9761162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 52 - 94
Target Start/End: Original strand, 21935483 - 21935525
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21935483 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
21935525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 23705226 - 23705176
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23705226 |
atccccgtgagcttagctcagttggtagggatattgcatattacatgcagg |
23705176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 42395225 - 42395275
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
42395225 |
tccctgtgagcttagcttagttggtagggatattgcatattatatgtaggg |
42395275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 45112184 - 45112134
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45112184 |
atccccgtgagcttacctcagttggtagggatattgcatattatatgcagg |
45112134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 40 - 90
Target Start/End: Complemental strand, 51512085 - 51512035
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51512085 |
gatatccccgtgagctgagctcagttggtagggatattgcatattatatgc |
51512035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 55536377 - 55536427
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55536377 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatgcagg |
55536427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 13578532 - 13578487
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13578532 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggg |
13578487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 17815500 - 17815447
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
17815500 |
atattcctgtgagcttagttcagttggtagggatattacatattatatgcaggg |
17815447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 46 - 95
Target Start/End: Complemental strand, 25175200 - 25175151
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25175200 |
cctgtgagcttagttcagttggtagggatattacatattatatgcaggga |
25175151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 27743775 - 27743730
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27743775 |
gtgagcgtagctcagttggtagggatattgcatattatatgcaggg |
27743730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 29771366 - 29771321
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29771366 |
gtgagcttagctcaattggtagggatattgcatattatatgcaggg |
29771321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 39697929 - 39697884
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39697929 |
gtgagcttagctcagttgatagggatattgcatattatatgcaggg |
39697884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 50457781 - 50457736
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50457781 |
gtgagcttagctcagttggtaaggatattgcatattatatgcaggg |
50457736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 3157291 - 3157239
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3157291 |
tatccccgtgaacttagctcagttggtaggaatattgcatattatatgcaggg |
3157239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 3815063 - 3815107
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3815063 |
gtgagcttagcttagttggtagggatattgcatattatatgcagg |
3815107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 4590242 - 4590294
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4590242 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatacaggg |
4590294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 5165853 - 5165905
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5165853 |
tatccccgtgagcttaactcagttggtagggatatcgcatattatatgcaggg |
5165905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 7686336 - 7686284
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
7686336 |
tatccccgtgagcttagctcagttggtagagatattgcattttatatgcaggg |
7686284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 12504710 - 12504666
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12504710 |
gtgagcttatctcagttggtagggatattgcatattatatgcagg |
12504666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 89
Target Start/End: Complemental strand, 39696404 - 39696364
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39696404 |
gtgagcttagctcagttggtagggatattgcatattatatg |
39696364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 89
Target Start/End: Complemental strand, 40994170 - 40994130
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40994170 |
gtgagcttagctcagttggtagggatattgcatattatatg |
40994130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 43 - 95
Target Start/End: Original strand, 45673649 - 45673701
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
||||| ||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45673649 |
atccccgtgagcttaactcagttggtaggaatattgcatattatatgcaggga |
45673701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 43 - 91
Target Start/End: Complemental strand, 50442814 - 50442766
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
50442814 |
atccctgtgagcttagctcagttggtagggataatgcataatatatgca |
50442766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 50512364 - 50512408
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50512364 |
tgagcttagctcagttggtaggaatattgcatattatatgcaggg |
50512408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 52757352 - 52757300
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
52757352 |
tatccccgtgagcttagctcagttggcaggaatattgcatattatatgcaggg |
52757300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 48 - 91
Target Start/End: Complemental strand, 627050 - 627007
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
627050 |
tgtgagtttagctcagttggtagggatattgcatattatatgca |
627007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 10402438 - 10402489
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10402438 |
atccccgtgagcttaactcagttggtagagatattgcatattatatgcaggg |
10402489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 50 - 93
Target Start/End: Complemental strand, 10417287 - 10417244
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10417287 |
tgagcttagctcagttggtagggatattacatattatatgcagg |
10417244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 50 - 136
Target Start/End: Complemental strand, 13264340 - 13264239
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggga---------------cggacaccccacttcttcacaatttaattgtgtgagctc |
134 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13264340 |
tgagcttcgctcagttggtagggatattgcatattatatgcaaggaccggggttcgaaccccggacaccccacttcttcacaattaaattgtgtgagctc |
13264241 |
T |
 |
| Q |
135 |
ta |
136 |
Q |
| |
|
|| |
|
|
| T |
13264240 |
ta |
13264239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 30057220 - 30057270
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30057220 |
atccctatgagct-agctcagttggtagggatattgcatattatatgcaggg |
30057270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 85
Target Start/End: Complemental strand, 35219574 - 35219531
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatatta |
85 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35219574 |
tatccccgtgagcttagctcagttggtagggatattgcatatta |
35219531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 35465432 - 35465483
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
35465432 |
atccccgtgagcttagctcagttggtagggatattgcattttatatacaggg |
35465483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 49 - 96
Target Start/End: Complemental strand, 43271784 - 43271737
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43271784 |
gtgagcttagttcagttgatagggatattgcatattatatgcagggac |
43271737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 51 - 94
Target Start/End: Complemental strand, 44312849 - 44312806
Alignment:
| Q |
51 |
gagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44312849 |
gagcttagctcagttggtagggatattgcattttatatgcaggg |
44312806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 637096 - 637146
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
637096 |
atccccgtgagcttagctcagctggtaggaatattgcatattatatgcagg |
637146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 1458091 - 1458041
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| || ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1458091 |
atccccgtaagcttagctcagttgatagggatattgcatattatatgcagg |
1458041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 6156643 - 6156717
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
6156643 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcctcttt |
6156717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 48 - 94
Target Start/End: Complemental strand, 8848280 - 8848234
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8848280 |
tgtgagcttagttcagttggtagggatattgcatattatatacaggg |
8848234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 33933811 - 33933761
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
33933811 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgcaggg |
33933761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 49757357 - 49757307
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49757357 |
atccccgtgagcatagctcagttggtaggaatattgcatattatatgcagg |
49757307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 52 - 94
Target Start/End: Complemental strand, 56088018 - 56087976
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
56088018 |
agcttagctcagttggtagggatattgcattttatatgcaggg |
56087976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 542881 - 542836
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
542881 |
gtgagcttagctcagttgatagggatattgcatattgtatgcaggg |
542836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 15604107 - 15604062
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
15604107 |
gtgagcttagctcagttggtagggatgttgcattttatatgcaggg |
15604062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 868 - 929
Target Start/End: Complemental strand, 36089023 - 36088962
Alignment:
| Q |
868 |
atgaatataacaagtggatgtccataaacccttgtatttatctcttaagtgacaacatatta |
929 |
Q |
| |
|
|||||||| | ||||| ||||||| |||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
36089023 |
atgaatatcataagtgaatgtccacaaacccttatatttatctcttaagtgacaccatatta |
36088962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 44 - 93
Target Start/End: Original strand, 37251111 - 37251160
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
37251111 |
tccccgtgagcttaactcagttggtagggatattgcatattttatgcagg |
37251160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 87
Target Start/End: Original strand, 42218746 - 42218791
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattata |
87 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42218746 |
tatccccgtgaacttagctcagttggtagggatattgcatattata |
42218791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 56479293 - 56479248
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
56479293 |
gtgaacttaactcagttggtagggatattgcatattatatgcaggg |
56479248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 50 - 94
Target Start/End: Complemental strand, 4701004 - 4700960
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4701004 |
tgagtttagctcagttggtagggatattgtatattatatgcaggg |
4700960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 15064269 - 15064225
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15064269 |
gtgagtttagctcagttggtaggaatattgcatattatatgcagg |
15064225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 18360489 - 18360541
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
18360489 |
tatccccgtgagcttagctcagttggtagggatatcacattttatatgcaggg |
18360541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 20203429 - 20203473
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
20203429 |
gtgagcttagctcatttggtagagatattgcatattatatgcagg |
20203473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 31852687 - 31852635
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||| |||||||||||||| |||||||||||||||| |||| |
|
|
| T |
31852687 |
tatccccgtgagcttatctcagttggtagggttattgcatattatatgtaggg |
31852635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 35207218 - 35207174
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
35207218 |
gtgagcttaactcagttgatagggatattgcatattatatgcagg |
35207174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 36602440 - 36602388
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
36602440 |
tatccccgtgagcttagctcagttggtagggatatcacattttatatgcaggg |
36602388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 42231515 - 42231559
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42231515 |
gtgagcttaactcagttggtaggaatattgcatattatatgcagg |
42231559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 43 - 87
Target Start/End: Original strand, 48798276 - 48798320
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattata |
87 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48798276 |
atccccgtgagcttagctcagttggtagggatattgcattttata |
48798320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 53572394 - 53572350
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
53572394 |
gtgagcttaactcagttgatagggatattgcatattatatgcagg |
53572350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 55 - 91
Target Start/End: Original strand, 54534835 - 54534871
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54534835 |
ttagctcagttggtagggatattgcatattatatgca |
54534871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 96
Target Start/End: Original strand, 2771039 - 2771086
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
||||||||||||||| || || |||||||||||||||||||||||||| |
|
|
| T |
2771039 |
gtgagcttagctcagctgatatggatattgcatattatatgcagggac |
2771086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 4105730 - 4105773
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
4105730 |
gtgagcttagctcagttgatagggatattgcattttatatgcag |
4105773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 46 - 89
Target Start/End: Complemental strand, 10407104 - 10407062
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10407104 |
cctgtgagcttagctcagttggta-ggatattgcatattatatg |
10407062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 53 - 88
Target Start/End: Complemental strand, 25726372 - 25726337
Alignment:
| Q |
53 |
gcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25726372 |
gcttagctcagttggtagggatattgcatattatat |
25726337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 976 - 1027
Target Start/End: Complemental strand, 26868298 - 26868247
Alignment:
| Q |
976 |
ttaagtcatatcattgtacttctctataaatagagaccacatgtaacataat |
1027 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
26868298 |
ttaagtcatatcattgtatttctctacaaatagagatcacatataacataat |
26868247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 43481112 - 43481061
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
43481112 |
atccccgtgagcttaactcagttggtagggatattgcactttatatgcaggg |
43481061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 92
Target Start/End: Complemental strand, 48615539 - 48615496
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
48615539 |
gtgagcataactcagttggtagggatattgcatattatatgcag |
48615496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 50 - 89
Target Start/End: Original strand, 49447125 - 49447164
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49447125 |
tgagcttagctcagttggtaaggatattgcatattatatg |
49447164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 55 - 94
Target Start/End: Original strand, 55021563 - 55021602
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55021563 |
ttagctcagttggtaggaatattgcatattatatgcaggg |
55021602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 5179955 - 5179905
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||| |||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5179955 |
atccccgtgaacttaactcagttggtaaggatattgcatattatatgcagg |
5179905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 42 - 96
Target Start/End: Original strand, 7657059 - 7657113
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
|||||| ||||||||| ||||||||||| |||| ||| ||||||||||||||||| |
|
|
| T |
7657059 |
tatccccgtgagcttatctcagttggtaaggatgttgtatattatatgcagggac |
7657113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 56 - 94
Target Start/End: Complemental strand, 12775299 - 12775261
Alignment:
| Q |
56 |
tagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12775299 |
tagctcagttggtagggatattgcattttatatgcaggg |
12775261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 20192659 - 20192585
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| | ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
20192659 |
tcattgtatttctctataaatagagcttatatgtaacctaattatacatcacaagagaataatataatcctcttt |
20192585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 20198023 - 20197949
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| | ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
20198023 |
tcattgtatttctctataaatagagcttatatgtaacctaattatacatcacaagagaataatataatcctcttt |
20197949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 95
Target Start/End: Original strand, 33530796 - 33530842
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||| ||||| |
|
|
| T |
33530796 |
gtgagcttagcttaattggtagggatattgcatattatatgtaggga |
33530842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 36132226 - 36132276
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||| |||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
36132226 |
atccccgtgagtttagctcaattggtaggaatattgcatattatatgcagg |
36132276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 48 - 94
Target Start/End: Original strand, 46206579 - 46206625
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
46206579 |
tgtgagcttagctcagttggtagggacattgcattatatatgcaggg |
46206625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 50 - 96
Target Start/End: Original strand, 48744212 - 48744258
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48744212 |
tgagcttagctcagttggtagggatataatatattatatgcagggac |
48744258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 41 - 91
Target Start/End: Complemental strand, 53376754 - 53376704
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
53376754 |
atatccccgcgagcttagctcaattggtagggatattgcatgttatatgca |
53376704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 53982186 - 53982260
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| ||||||||||||| ||||| ||||| |
|
|
| T |
53982186 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataacataatcctcttt |
53982260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 55055914 - 55055964
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||||||||||| | |||||||| ||||||||| |
|
|
| T |
55055914 |
tccccgtgagcttagctcagttggtagggacaatgcatattttatgcaggg |
55055964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 3784915 - 3784960
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| | ||||||||| |
|
|
| T |
3784915 |
gtgagcttagctcaattggtagggatattgcataatttatgcaggg |
3784960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 43 - 88
Target Start/End: Original strand, 15208519 - 15208564
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
||||| ||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
15208519 |
atccccgtgagcttaactcagtgggtagggatattgcatattatat |
15208564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 43 - 88
Target Start/End: Complemental strand, 22654107 - 22654062
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| |||||| |
|
|
| T |
22654107 |
atccctgtgagcttagctcaattggtaggaatattgcattttatat |
22654062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 86
Target Start/End: Complemental strand, 24997501 - 24997464
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattat |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24997501 |
gtgagcttagctcagttggtagggatattgcattttat |
24997464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 27362896 - 27362851
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||||||| |||||| |||||||||||||||| |
|
|
| T |
27362896 |
gtgagcttaactcagttggtagcgatattacatattatatgcaggg |
27362851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 58 - 95
Target Start/End: Original strand, 31016348 - 31016385
Alignment:
| Q |
58 |
gctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31016348 |
gctcagttggtagggatattgcatattatatgtaggga |
31016385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 38228440 - 38228485
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||| |||| |
|
|
| T |
38228440 |
gtgagcttagatcagttggtagggatattgcatgttatatgtaggg |
38228485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 99 - 136
Target Start/End: Complemental strand, 39697865 - 39697828
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39697865 |
acaccccacttcttcacaattaaattgtgtgagctcta |
39697828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 50 - 91
Target Start/End: Complemental strand, 42134523 - 42134482
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
42134523 |
tgagcttaactcagttagtagggatattgcatattatatgca |
42134482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 42381180 - 42381135
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
42381180 |
gtgaacttagctcagttggtagggatattgcatgttatatgtaggg |
42381135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 54 - 95
Target Start/End: Original strand, 43905718 - 43905759
Alignment:
| Q |
54 |
cttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43905718 |
cttaactcagttggtagggatattgcatgttatatgcaggga |
43905759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 44195699 - 44195646
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||| |||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
44195699 |
atatccatgtgaacttaattcagttggtagggatattgcattttatatgcaggg |
44195646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 48 - 93
Target Start/End: Complemental strand, 46998436 - 46998391
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||| | |||||| |||||||||||||| |
|
|
| T |
46998436 |
tgtgagcttagctcagttggtatgaatattgtatattatatgcagg |
46998391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 47890690 - 47890743
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| ||||| | | |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47890690 |
atatccccgtgagttaaactcagttggtagagatattgcatattatatgcaggg |
47890743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 47929240 - 47929293
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
47929240 |
atatctctgtgagcttagctcatttggtgagaatattgcatattatatgcaggg |
47929293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 49056777 - 49056822
Alignment:
| Q |
49 |
gtgagctta-gctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49056777 |
gtgagcttaagctcagttggtagggacattgcatattatatgcagg |
49056822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 96 - 137
Target Start/End: Original strand, 49056840 - 49056881
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctctat |
137 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
49056840 |
cggacaccccacttctccacaattaaattgtgtgagctctat |
49056881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 53 - 94
Target Start/End: Complemental strand, 54443943 - 54443902
Alignment:
| Q |
53 |
gcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
54443943 |
gcttagcttaggtggtagggatattgcatattatatgcaggg |
54443902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 2222604 - 2222644
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
2222604 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
2222644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 3036060 - 3036020
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
3036060 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
3036020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 4700943 - 4700903
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
4700943 |
cggacatcccacttctccacaatttaattgtgtgagctcta |
4700903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 6371179 - 6371219
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
6371179 |
cggacactccacttcttcacaattaaattgtgtgagctcta |
6371219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 54 - 94
Target Start/End: Complemental strand, 8144653 - 8144613
Alignment:
| Q |
54 |
cttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
8144653 |
cttagctcagtttgtagggatattgcatattatatgtaggg |
8144613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 12267583 - 12267623
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
12267583 |
cggacaccccacttctccacaatataattgtgtgagctcta |
12267623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 12582095 - 12582051
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||| | || |||||||||||||||||||||||||||||||| |
|
|
| T |
12582095 |
gtgagctaatcttagttggtagggatattgcatattatatgcagg |
12582051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 54 - 94
Target Start/End: Original strand, 12763764 - 12763804
Alignment:
| Q |
54 |
cttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
12763764 |
cttagctcagttgctagggatattgcatattatatacaggg |
12763804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 89
Target Start/End: Complemental strand, 18424964 - 18424924
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18424964 |
gtgaacttaactcagttggtagggatattgcatattatatg |
18424924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 62 - 94
Target Start/End: Original strand, 19963798 - 19963830
Alignment:
| Q |
62 |
agttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
19963798 |
agttggtagggatattgcatattatatgcaggg |
19963830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 21380257 - 21380205
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||| ||||| |||||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
21380257 |
atatccccgtgagtttagctcaattgctagggatattgcatattataagcagg |
21380205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 132
Target Start/End: Complemental strand, 22788679 - 22788643
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagc |
132 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22788679 |
cggacaccccacttctccacaatttaattgtgtgagc |
22788643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 26919473 - 26919433
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
26919473 |
cggacactccacttcttcacaattaaattgtgtgagctcta |
26919433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 53 - 89
Target Start/End: Complemental strand, 27103164 - 27103128
Alignment:
| Q |
53 |
gcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27103164 |
gcttagcttagttggtagggatattgcatattatatg |
27103128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 29329897 - 29329845
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||| || ||||||| |||| |
|
|
| T |
29329897 |
tatccccgtgagcttagctcagttggtaggaatattgtattttatatgtaggg |
29329845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 30057287 - 30057327
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
30057287 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
30057327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 51 - 91
Target Start/End: Original strand, 32339329 - 32339369
Alignment:
| Q |
51 |
gagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
32339329 |
gagcttaactcagttgttagggatattgcatattatatgca |
32339369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 1013 - 1076
Target Start/End: Complemental strand, 36088920 - 36088859
Alignment:
| Q |
1013 |
cacatgtaacataattgtacaccacaagagaataatgtaatcatctttgtttctctctgcttct |
1076 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||| ||||| ||||||||||||||| ||||| |
|
|
| T |
36088920 |
cacatgtaacatcattgtact--acaagagaataatataatcgtctttgtttctctcttcttct |
36088859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 37868641 - 37868589
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||| || |||| |||| ||||||||||||||||||||||| |
|
|
| T |
37868641 |
tatctctgtgagcttaacttagttagtagtgatattgcatattatatgcaggg |
37868589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 44 - 92
Target Start/End: Complemental strand, 40809253 - 40809205
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||| | ||||||| |
|
|
| T |
40809253 |
tccctgtgagcttagttcagttggtagggatattgtataatttatgcag |
40809205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 46903335 - 46903379
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
46903335 |
tgagtttagatcagttggtatggatattgcatattatatgcaggg |
46903379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 47934077 - 47934037
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
47934077 |
cggacactccacttctccacaatttaattgtgtgagctcta |
47934037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 48949694 - 48949734
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
48949694 |
cggacactccacttctccacaatttaattgtgtgagctcta |
48949734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 49022957 - 49023001
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatatta |
85 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
49022957 |
atatccctgtgaacttaactcagttggtaggaatattgcatatta |
49023001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 55531250 - 55531302
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| || ||||||||||||||||| ||||||| |||| |||||||||||| |
|
|
| T |
55531250 |
tatccccgtaagcttagctcagttggtggggatatcgcattttatatgcaggg |
55531302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 56360786 - 56360734
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
56360786 |
tatccccgtgaatttagctcagttggtagggatattgcgtattatatgtaggg |
56360734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 4357879 - 4357930
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||| ||||||||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
4357879 |
atccccgtgaacttagctcagttggtagagatattgtatattatatgtaggg |
4357930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 94
Target Start/End: Original strand, 12267527 - 12267566
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
12267527 |
ttagctcagttggtagagatattgcatattatatgtaggg |
12267566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 59 - 94
Target Start/End: Original strand, 12678520 - 12678555
Alignment:
| Q |
59 |
ctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12678520 |
ctcagttggtagagatattgcatattatatgcaggg |
12678555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 17872084 - 17872135
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||| | ||||||||||||||||||| ||||| ||||| |
|
|
| T |
17872084 |
atccccgtgagcttagcttaattggtagggatattgcatagtatatacaggg |
17872135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 88
Target Start/End: Original strand, 21432617 - 21432656
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
21432617 |
gtgagcttagttcagttggtagagatattgcatattatat |
21432656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 89
Target Start/End: Original strand, 25526447 - 25526486
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
25526447 |
tgagcttaactcagttggtagggatattgtatattatatg |
25526486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 94
Target Start/End: Original strand, 29406358 - 29406405
Alignment:
| Q |
47 |
ctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| | ||||||||| |
|
|
| T |
29406358 |
ctgtgagcttagctcaattggtagggacattgcataatttatgcaggg |
29406405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 91
Target Start/End: Original strand, 38416056 - 38416099
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
38416056 |
tgtgagcttagctcagttggtaaggataatgcataatatatgca |
38416099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 969 - 1032
Target Start/End: Complemental strand, 51835211 - 51835148
Alignment:
| Q |
969 |
ttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaacataattgtac |
1032 |
Q |
| |
|
|||||| ||| |||||||||||||||||| ||||||||| ||| ||| |||||||||||||| |
|
|
| T |
51835211 |
ttaactgttacgtcatatcattgtacttcgctataaataaagattgcatctaacataattgtac |
51835148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 89
Target Start/End: Complemental strand, 52483250 - 52483204
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
52483250 |
tatccccgtgagcttagctcagttggta-ggatgttgcatattatatg |
52483204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 93
Target Start/End: Complemental strand, 53634317 - 53634274
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||| |||| |
|
|
| T |
53634317 |
tgagcttagttcagttcgtagggatattgcatattatatacagg |
53634274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 59 - 94
Target Start/End: Complemental strand, 54103621 - 54103586
Alignment:
| Q |
59 |
ctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54103621 |
ctcagttgatagggatattgcatattatatgcaggg |
54103586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 94
Target Start/End: Complemental strand, 481609 - 481567
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||| |||| |
|
|
| T |
481609 |
agcttagcttagttggtagagatattgcatattatatgtaggg |
481567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 1439621 - 1439663
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
1439621 |
gtgaacttagctcagttggtatggacattgcatattatatgca |
1439663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 82
Target Start/End: Complemental strand, 2609457 - 2609427
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcata |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2609457 |
agcttagctcagttggtagggatattgcata |
2609427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 13550997 - 13551047
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
13550997 |
atccctgtaaacttagttcagttggtagggatatcacatattatatgcagg |
13551047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Complemental strand, 13564271 - 13564233
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
13564271 |
gacactccacttctacacaatttaattgtgtgagctcta |
13564233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 20799455 - 20799413
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
20799455 |
gtgagcttagctcagttggtagggacaatgcataatatatgca |
20799413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 48 - 94
Target Start/End: Complemental strand, 21162312 - 21162266
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| || |||||||||| ||||| |||||||||||||||| |
|
|
| T |
21162312 |
tgtgagcttaacttagttggtaggaatattacatattatatgcaggg |
21162266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 22819475 - 22819513
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
22819475 |
gacactccactttttcacaatttaattgtgtgagctcta |
22819513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Complemental strand, 23778828 - 23778790
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
23778828 |
gacaccccacttctccacaattaaattgtgtgagctcta |
23778790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 48 - 94
Target Start/End: Complemental strand, 35851769 - 35851723
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| |||||| |||| |
|
|
| T |
35851769 |
tgtgagcttaactcagttggtagggacattgcataatatatgtaggg |
35851723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 40051689 - 40051727
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
40051689 |
gacaccccacttctccacaattaaattgtgtgagctcta |
40051727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 83
Target Start/End: Complemental strand, 47230972 - 47230938
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatat |
83 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
47230972 |
gtgagcttagctcagttggtagagatattgcatat |
47230938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Complemental strand, 48569179 - 48569141
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
48569179 |
gacactccacttctccacaatttaattgtgtgagctcta |
48569141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 50362200 - 50362158
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
50362200 |
gtgagcttagctcagttggtagggacaatgcataatatatgca |
50362158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 95
Target Start/End: Original strand, 51777847 - 51777893
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
51777847 |
gtgagtttagctcagttagtagctatattgcatattatatgcaggga |
51777893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 51791319 - 51791357
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
51791319 |
gacactccacttcttcacaattaaattgtgtgagctcta |
51791357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 91
Target Start/End: Original strand, 1332897 - 1332946
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||| | ||||||||||| |||||||||| |||||||| |||||||| |
|
|
| T |
1332897 |
tatccctataagcttagctcaattggtagggacattgcataatatatgca |
1332946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 64 - 93
Target Start/End: Original strand, 2688114 - 2688143
Alignment:
| Q |
64 |
ttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2688114 |
ttggtagggatattgcatattatatgcagg |
2688143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 98 - 135
Target Start/End: Original strand, 5165923 - 5165960
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctct |
135 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
5165923 |
gacactccacttctccacaatttaattgtgtgagctct |
5165960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 5305077 - 5305032
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||||| |||| |||| |||||||||||| |
|
|
| T |
5305077 |
gtgagcttatctcagttggtaggaatatcgcattttatatgcaggg |
5305032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 6930554 - 6930599
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| || ||||||||||||||| ||||||||||| |
|
|
| T |
6930554 |
gtgagattagctcagctgctagggatattgcataatatatgcaggg |
6930599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 48 - 89
Target Start/End: Complemental strand, 8061979 - 8061938
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||| |
|
|
| T |
8061979 |
tgtgagcttaactcagttggtcgggatattgcagattatatg |
8061938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 8282345 - 8282390
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||| ||| || |||||||||||||||||||||||| |
|
|
| T |
8282345 |
gtgagcttaactcaattgataaggatattgcatattatatgcaggg |
8282390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 60 - 89
Target Start/End: Complemental strand, 10042474 - 10042445
Alignment:
| Q |
60 |
tcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10042474 |
tcagttggtagggatattgcatattatatg |
10042445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 133
Target Start/End: Complemental strand, 13578470 - 13578433
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagct |
133 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
13578470 |
cggacaccccacttctccacaattaaattgtgtgagct |
13578433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 13641081 - 13641126
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
13641081 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggg |
13641126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 17683962 - 17683917
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||| |||||||||||| || |||||||||||| |
|
|
| T |
17683962 |
gtgagcttaactcagttagtagggatattggattttatatgcaggg |
17683917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 19594236 - 19594281
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
19594236 |
gtgagcttaactcagttgatagagatattgcatattatatgtaggg |
19594281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 136
Target Start/End: Complemental strand, 19933802 - 19933765
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
19933802 |
acactccactttttcacaatttaattgtgtgagctcta |
19933765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 56 - 89
Target Start/End: Complemental strand, 19933860 - 19933827
Alignment:
| Q |
56 |
tagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
19933860 |
tagctcagttggtagggataatgcatattatatg |
19933827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 61 - 94
Target Start/End: Original strand, 20320456 - 20320489
Alignment:
| Q |
61 |
cagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
20320456 |
cagttggtagggatatcgcatattatatgcaggg |
20320489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 91
Target Start/End: Original strand, 21116777 - 21116826
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||| ||||||||| |||||||| || | ||||||||||||||||||| |
|
|
| T |
21116777 |
tatccccgtgagcttaactcagttgttaagaatattgcatattatatgca |
21116826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 133
Target Start/End: Original strand, 21935542 - 21935579
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagct |
133 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
21935542 |
cggacaccccacttctccacaattaaattgtgtgagct |
21935579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 995 - 1048
Target Start/End: Complemental strand, 28295291 - 28295239
Alignment:
| Q |
995 |
ttctctataaatagagaccacatgtaacataattgtacaccacaagagaataat |
1048 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||| |||| ||||||||| |
|
|
| T |
28295291 |
ttctctataaatagagctcacatgtaacatacttgtaca-cacatgagaataat |
28295239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 52 - 89
Target Start/End: Original strand, 33107362 - 33107399
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
33107362 |
agcttagctcagttggtaaggatattgtatattatatg |
33107399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 34932498 - 34932543
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
34932498 |
gtgagcttagctcagttggtaggaatattgcacgttatatgtaggg |
34932543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 36215323 - 36215368
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| |||||||||| |||| |
|
|
| T |
36215323 |
gtgagcttagatcagttgatagggatattgtatattatatgtaggg |
36215368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 37310030 - 37310075
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
37310030 |
gtgagtttaactcagttggtatggatattgcatattatatgtaggg |
37310075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 43 - 88
Target Start/End: Complemental strand, 37700672 - 37700627
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
||||| ||||| ||| ||| |||||||||||||||||||||||||| |
|
|
| T |
37700672 |
atccccgtgagtttacctcggttggtagggatattgcatattatat |
37700627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 37719003 - 37719048
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||| ||||||||| |||| |||||||||||| |
|
|
| T |
37719003 |
gtgagcttaactcagttgttagggatatcgcattttatatgcaggg |
37719048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 38690666 - 38690711
Alignment:
| Q |
50 |
tgagcttagctcagttggta-gggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||| |||||| |||||| |||||||||||||||||| |
|
|
| T |
38690666 |
tgagcttagctcacttggtaagggataatgcatattatatgcaggg |
38690711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 133
Target Start/End: Original strand, 42218815 - 42218852
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagct |
133 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
42218815 |
cggacactccacttctccacaatttaattgtgtgagct |
42218852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 133
Target Start/End: Original strand, 42395292 - 42395329
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagct |
133 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
42395292 |
cggacaccccacttctccacaattaaattgtgtgagct |
42395329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 45139948 - 45139903
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||| | ||||||||| |
|
|
| T |
45139948 |
gtgagcttagctcagttggtagggacattgtataatttatgcaggg |
45139903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 73
Target Start/End: Complemental strand, 46545605 - 46545576
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtaggga |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46545605 |
tccctgtgagcttagctcagttggtaggga |
46545576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 133
Target Start/End: Original strand, 50730334 - 50730371
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagct |
133 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
50730334 |
cggacaccccacttctccacaattaaattgtgtgagct |
50730371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 51890800 - 51890845
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| | ||||||||| |
|
|
| T |
51890800 |
gtgagcttagctcagttggcagggacattgcataatttatgcaggg |
51890845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 136
Target Start/End: Original strand, 52798345 - 52798382
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
52798345 |
acactccacttctccacaatttaattgtgtgagctcta |
52798382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 92; Significance: 4e-44; HSPs: 185)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 4e-44
Query Start/End: Original strand, 966 - 1077
Target Start/End: Complemental strand, 22575952 - 22575841
Alignment:
| Q |
966 |
tacttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatctttgtttc |
1065 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||| |||||| |
|
|
| T |
22575952 |
tacttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaacataattgaacactacaagagaataatataatcatctatgtttc |
22575853 |
T |
 |
| Q |
1066 |
tctctgcttctc |
1077 |
Q |
| |
|
||||| |||||| |
|
|
| T |
22575852 |
tctcttcttctc |
22575841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 39 - 94
Target Start/End: Complemental strand, 35605700 - 35605645
Alignment:
| Q |
39 |
ggatatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35605700 |
ggatatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
35605645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 40 - 93
Target Start/End: Complemental strand, 1570268 - 1570215
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1570268 |
gatatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
1570215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 22563382 - 22563434
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22563382 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
22563434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 41 - 93
Target Start/End: Original strand, 46965735 - 46965787
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46965735 |
atatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
46965787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 3269616 - 3269667
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3269616 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
3269667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 6438138 - 6438087
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6438138 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
6438087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 7166300 - 7166249
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7166300 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
7166249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 8865851 - 8865902
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8865851 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
8865902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 21265653 - 21265704
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21265653 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
21265704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 25999846 - 25999897
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25999846 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
25999897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 26584820 - 26584769
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26584820 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
26584769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 33207202 - 33207253
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33207202 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
33207253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 40519618 - 40519567
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40519618 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
40519567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 42490483 - 42490432
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42490483 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
42490432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 4482671 - 4482621
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4482671 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
4482621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 6702573 - 6702623
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6702573 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
6702623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 15819674 - 15819624
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15819674 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
15819624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 32594248 - 32594298
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32594248 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
32594298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 33254725 - 33254775
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33254725 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
33254775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 33274897 - 33274947
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33274897 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
33274947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 50899583 - 50899533
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50899583 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
50899533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 9866251 - 9866206
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9866251 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
9866206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 10664867 - 10664818
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10664867 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcag |
10664818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 11215004 - 11215049
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11215004 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
11215049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 18467273 - 18467220
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18467273 |
atatccccgtgagcatagctcagttggtagggatattgcatattatatgcaggg |
18467220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 37662624 - 37662579
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37662624 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
37662579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 47402738 - 47402685
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47402738 |
atatccccgtgagcttagctcagctggtagggatattgcatattatatgcaggg |
47402685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 2277757 - 2277801
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2277757 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
2277801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 2556552 - 2556604
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2556552 |
tatccccgtaagcttagctcagttggtagggatattgcatattatatgcaggg |
2556604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 6893311 - 6893259
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6893311 |
tatccccgtgagcttagctcagttggtagggatattgcattttatatgcaggg |
6893259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 16343031 - 16343075
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16343031 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
16343075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 34058217 - 34058261
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34058217 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
34058261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 48638528 - 48638580
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48638528 |
tatccccgtgagcttagctcagttggtagggatattgcattttatatgcaggg |
48638580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 1151755 - 1151806
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1151755 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatacagg |
1151806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 1836500 - 1836551
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1836500 |
atccccgtgagcttagctcagttggtagggatattacatattatatgcaggg |
1836551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 6130107 - 6130056
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6130107 |
tatccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
6130056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 13773164 - 13773215
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13773164 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatgcagg |
13773215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 18551706 - 18551655
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18551706 |
atccccgtgagcttagctcagttggtatggatattgcatattatatgcaggg |
18551655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 40375389 - 40375338
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40375389 |
tatccccgtgagcatagctcagttggtagggatattgcatattatatgcagg |
40375338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 42054330 - 42054381
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42054330 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgtaggg |
42054381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 43884790 - 43884841
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43884790 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatgcagg |
43884841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 51050187 - 51050238
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51050187 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgcaggg |
51050238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 16526250 - 16526200
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16526250 |
atccccgtgagcttagctcaattggtagggatattgcatattatatgcagg |
16526200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 973 - 1039
Target Start/End: Original strand, 29644973 - 29645039
Alignment:
| Q |
973 |
ctcttaagtcatatcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaa |
1039 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| | | |||||||||||||||| |||| ||||| |
|
|
| T |
29644973 |
ctcttaaatcatatcattgtacttctctataaataaaaatcacatgtaacataattatacatcacaa |
29645039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 7180689 - 7180636
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7180689 |
atatccccgtgaggttagctcagttggtaggaatattgcatattatatgcaggg |
7180636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 8415732 - 8415777
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8415732 |
gtgagcttagctcagttcgtagggatattgcatattatatgcaggg |
8415777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 19011358 - 19011403
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19011358 |
gtgagcttagctcaattggtagggatattgcatattatatgcaggg |
19011403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 42299580 - 42299535
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42299580 |
gtgagcttagttcagttggtagggatattgcatattatatgcaggg |
42299535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 42 - 91
Target Start/End: Original strand, 44732629 - 44732678
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44732629 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatgca |
44732678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 46225390 - 46225435
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46225390 |
gtgagcttagctcagttggtagggatattgcattttatatgcaggg |
46225435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 52426980 - 52426935
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52426980 |
gtgagcttagctcagttgatagggatattgcatattatatgcaggg |
52426935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 2754356 - 2754404
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2754356 |
tatccccgtgagcttagcttagttggtagggatattgcatattatatgc |
2754404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 43 - 91
Target Start/End: Original strand, 40520827 - 40520875
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40520827 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgca |
40520875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 52369600 - 52369644
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52369600 |
gtgagtttagctcagttggtagggatattgcatattatatgcagg |
52369644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 2352639 - 2352588
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
2352639 |
tatccccgtgagcttagctcagttgatagagatattgcatattatatgcagg |
2352588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 13538519 - 13538468
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13538519 |
atcccagtgaacttagttcagttggtagggatattgcatattatatgcaggg |
13538468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 23545528 - 23545477
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23545528 |
tatccccgtgagctaagcttagttggtagggatattgcatattatatgcagg |
23545477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 26550490 - 26550541
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
26550490 |
tatccccgtgagcttaactcagttggtagggatattgcatactatatgcagg |
26550541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 29188632 - 29188683
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29188632 |
tatccccgtgattttagctcagttggtagggatattgcatattatatgcagg |
29188683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 49 - 92
Target Start/End: Complemental strand, 32556996 - 32556953
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32556996 |
gtgagcttagctcagctggtagggatattgcatattatatgcag |
32556953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 49 - 96
Target Start/End: Original strand, 33033129 - 33033176
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33033129 |
gtgagcttaattcagttggtagggatattgcatattatatgcagggac |
33033176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 50 - 93
Target Start/End: Complemental strand, 46161189 - 46161146
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46161189 |
tgagcttagctcagttggtaggaatattgcatattatatgcagg |
46161146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 50 - 93
Target Start/End: Original strand, 51933510 - 51933553
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51933510 |
tgagcttagctcaattggtagggatattgcatattatatgcagg |
51933553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 12502327 - 12502277
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| || ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12502327 |
atccccgtaagcatagctcagttggtagggatattgcatattatatgcagg |
12502277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 15716716 - 15716790
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
15716716 |
tcattgtatttctctataaatagagctcatatgtaacgtaattatacatcacaagagaataatataatcttcttt |
15716790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Original strand, 17580317 - 17580363
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17580317 |
cctgtgaacttagctcagttggtagggatattgcatgttatatgcag |
17580363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 866 - 920
Target Start/End: Complemental strand, 22576031 - 22575977
Alignment:
| Q |
866 |
ttatgaatataacaagtggatgtccataaacccttgtatttatctcttaagtgac |
920 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||| |||| ||||||||||| |
|
|
| T |
22576031 |
ttatgaatataataagtggatgtccagaaacccttgtacttatttcttaagtgac |
22575977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 27179037 - 27178963
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
27179037 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcctcttt |
27178963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 27195038 - 27194964
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
27195038 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcctcttt |
27194964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 52 - 94
Target Start/End: Complemental strand, 27642790 - 27642748
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27642790 |
agcttagctcagttggtagggatattgcattttatatgcaggg |
27642748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 49 - 95
Target Start/End: Original strand, 27650700 - 27650746
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27650700 |
gtgagctaagttcagttggtagggatattgcatattatatgcaggga |
27650746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 50 - 88
Target Start/End: Original strand, 27818573 - 27818611
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27818573 |
tgagcttagctcagttggtagggatattgcatattatat |
27818611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 50 - 92
Target Start/End: Complemental strand, 42848797 - 42848755
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42848797 |
tgagcttagctcagttgatagggatattgcatattatatgcag |
42848755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 49 - 95
Target Start/End: Complemental strand, 47478915 - 47478869
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47478915 |
gtgagcttaactcagttggtagggatattgcatattatatgtaggga |
47478869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 56 - 94
Target Start/End: Complemental strand, 47930731 - 47930693
Alignment:
| Q |
56 |
tagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47930731 |
tagctcagttggtagggatattgcatattatatgcaggg |
47930693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 6712176 - 6712131
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
6712176 |
gtgagcttagctcagttggtaggtatattgcattttatatgcaggg |
6712131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 7191035 - 7191080
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7191035 |
gtgaccttagctcagttgatagggatattgcatattatatgcaggg |
7191080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 15390223 - 15390268
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15390223 |
gtgagcttaactcagttggtagggatattgcatattagatgcaggg |
15390268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 91
Target Start/End: Original strand, 18216902 - 18216951
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
18216902 |
tatccccgtgagcttagctcagttggtagggatattacatattttatgca |
18216951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 89
Target Start/End: Complemental strand, 3694982 - 3694942
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3694982 |
gtgagcttagctcagttggaagggatattgcatattatatg |
3694942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 3768047 - 3767995
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcata-ttatatgcaggg |
94 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3768047 |
atccctgtgaatttagctcagttggtagggatattgcatatttatatgcaggg |
3767995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 50 - 94
Target Start/End: Complemental strand, 5190847 - 5190803
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
5190847 |
tgagcttagctcaattggtagggatatcgcatattatatgcaggg |
5190803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 6213417 - 6213469
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||| ||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
6213417 |
tatcactgtgaacttagctcaattggtagggatattgcatattatatacaggg |
6213469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 50 - 94
Target Start/End: Complemental strand, 6463102 - 6463058
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
6463102 |
tgagcttagctcagttggtagggatattgtattttatatgcaggg |
6463058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 8780765 - 8780816
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| ||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8780765 |
tatccctgtg-gcttaactcagttggtacggatattgcatattatatgcaggg |
8780816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 8984572 - 8984528
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8984572 |
gtgagcttaactcagttggcagggatattgcatattatatgcagg |
8984528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 12374519 - 12374479
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12374519 |
cggacaccccacttcttcacaattaaattgtgtgagctcta |
12374479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 12404352 - 12404404
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||| |||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12404352 |
tatccccgtgagattagatcaattggtagggatattgcatattatatgcaggg |
12404404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 14760823 - 14760774
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14760823 |
tatccccgtgagcttagctcagttggta--gatattgcatattatatgcagg |
14760774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 15775742 - 15775786
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
15775742 |
gtgagcttaactcaattggtagggatattgcatattatatgcagg |
15775786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 986 - 1058
Target Start/End: Original strand, 17721831 - 17721903
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatct |
1058 |
Q |
| |
|
||||| || |||||||||||||||| | ||||||| |||||||||| |||||||||||||| ||||||||| |
|
|
| T |
17721831 |
tcattatatttctctataaatagagctcgtatgtaacctaattgtacatcacaagagaataatataatcatct |
17721903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 89
Target Start/End: Original strand, 18534004 - 18534044
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18534004 |
gtgagcttagctcagttggtagagatattgcatattatatg |
18534044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 19063338 - 19063298
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19063338 |
cggacaccccacttctccacaatttaattgtgtgagctcta |
19063298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 54 - 94
Target Start/End: Original strand, 24253780 - 24253820
Alignment:
| Q |
54 |
cttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24253780 |
cttagctcatttggtagggatattgcatattatatgcaggg |
24253820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 34580861 - 34580809
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||| ||||| | |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34580861 |
atatccccgtgagttcagctcagttggtagggatattgtatattatatgcagg |
34580809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 35121119 - 35121071
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||| |||||||| |
|
|
| T |
35121119 |
cctgtgagcttagcttagttggtagcgatattgcatattacatgcaggg |
35121071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 54 - 94
Target Start/End: Original strand, 45271774 - 45271814
Alignment:
| Q |
54 |
cttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45271774 |
cttagttcagttggtagggatattgcatattatatgcaggg |
45271814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 51942359 - 51942399
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51942359 |
cggacaccccacttctccacaatttaattgtgtgagctcta |
51942399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 4553619 - 4553568
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
4553619 |
atccccgtgagcttaactcagttggtagaaatattgcatattatatgcaggg |
4553568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 11065117 - 11065168
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||| || ||| ||||||||||||||||||||||| |
|
|
| T |
11065117 |
atccccgtgagcttagctcagatgatagagatattgcatattatatgcaggg |
11065168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 17671483 - 17671432
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||| | |||||||||| |
|
|
| T |
17671483 |
atccccgtgagcttagctcagttggtagggatatcgcatttcatatgcaggg |
17671432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 34271841 - 34271892
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||| ||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
34271841 |
atccccgtgagtttagctcagctggtagggatattacatattatatgcaggg |
34271892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 59 - 94
Target Start/End: Original strand, 40634214 - 40634249
Alignment:
| Q |
59 |
ctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40634214 |
ctcagttggtagggatattgcatattatatgcaggg |
40634249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 45333784 - 45333734
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
45333784 |
atccccgtgagcttagctcagttggcagggatattgcata-tatatgcaggg |
45333734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 46021953 - 46021902
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46021953 |
tatccccgtgagcgtagctcagtaagtagggatattgcatattatatgcagg |
46021902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 48897190 - 48897139
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
48897190 |
atccccgtgagcttaactcatttggtaggaatattgcatattatatgcaggg |
48897139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 42 - 89
Target Start/End: Original strand, 50746707 - 50746754
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50746707 |
tatccctgtgaccttagctcagttggtagggatatcacatattatatg |
50746754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 54 - 93
Target Start/End: Complemental strand, 50824472 - 50824433
Alignment:
| Q |
54 |
cttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50824472 |
cttagttcagttggtagggatattgcatattatatgcagg |
50824433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 55 - 93
Target Start/End: Complemental strand, 923165 - 923127
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
923165 |
ttagcgcagttggtagggatattgcatattatatgcagg |
923127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 95
Target Start/End: Original strand, 14349647 - 14349693
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
14349647 |
gtgaacttagctcagttggtagagatattgcatattatatgtaggga |
14349693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 15595728 - 15595770
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
15595728 |
gtgagcttagctcagttggtagggacattgcataatatatgca |
15595770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 15711135 - 15711209
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||| ||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
15711135 |
tcattgtatttctttataaatagagctcatatgtaacgtaattatacatcacaagagaataatataatcttcttt |
15711209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 16182201 - 16182243
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
16182201 |
gtgagcttagctgagttggtagagatattgcatattatatgca |
16182243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 24874974 - 24875016
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
24874974 |
gtgagcttagctcagttggtagggatattgcataatttatgca |
24875016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 26711544 - 26711470
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| ||| |||||||||||||| ||||| ||||| |
|
|
| T |
26711544 |
tcattgtatttctctataaatagagctcatatgtaacctaattagacatcacaagagaataatataatcctcttt |
26711470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 42 - 88
Target Start/End: Complemental strand, 31762070 - 31762024
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
|||||| ||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
31762070 |
tatcccagtgagcttagctcagttggcagtgatattgcatattatat |
31762024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 56 - 94
Target Start/End: Complemental strand, 36314039 - 36314001
Alignment:
| Q |
56 |
tagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36314039 |
tagctcagttggtagggatattgcatattatttgcaggg |
36314001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 95
Target Start/End: Complemental strand, 37403192 - 37403146
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
37403192 |
gtgagcttggctcagttagtagggatattgcataatatatgcaggga |
37403146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 43668030 - 43667980
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| || |||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
43668030 |
atccccgtaagcttagctcagttcgtagagatattgcatattatatgcagg |
43667980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 44019279 - 44019321
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
44019279 |
gtgagcttagctcagttgatagggatattgcattttatatgca |
44019321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 42 - 88
Target Start/End: Complemental strand, 47643058 - 47643012
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||| |||||| |
|
|
| T |
47643058 |
tatccctgttaacttagctcagttggtagggatattgcattttatat |
47643012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 95
Target Start/End: Original strand, 49253613 - 49253658
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
49253613 |
gtgagcttagctaagttggtagg-atattgcatattatatgcaggga |
49253658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 3560448 - 3560403
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3560448 |
gtgagcttaactcagttggtagggatattatatattatatgcaggg |
3560403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 10851827 - 10851872
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
10851827 |
gtgagcttagctcaattggtaaggatattgtatattatatgcaggg |
10851872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 20030081 - 20030126
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
20030081 |
gtgagcttatctcagttggtaggaatattgcattttatatgcaggg |
20030126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 25034907 - 25034952
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
25034907 |
gtgagcttagctcagttggtaggaatattgcattttatatgtaggg |
25034952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 90
Target Start/End: Original strand, 25580691 - 25580732
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
25580691 |
gtgagcttaactcagttggtagagatattgcatattatatgc |
25580732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 27344482 - 27344527
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
27344482 |
gtgagcttagctcagttggtagacatattgcatattatatgtaggg |
27344527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 28867482 - 28867527
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
28867482 |
gtgaacttagctcagttggtaggaatattgcatattatatggaggg |
28867527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 36666643 - 36666598
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | ||||||||| |
|
|
| T |
36666643 |
gtgagcttagctcagttggtagggacattgcataatttatgcaggg |
36666598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 41709990 - 41709945
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||| |||||||||||||||||| | |||||||||||| |
|
|
| T |
41709990 |
gtgagcttagcttagttggtagggatattgcgtgttatatgcaggg |
41709945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 42550076 - 42550031
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| |||||||| |
|
|
| T |
42550076 |
gtgagcttagctcaatcggtagggatattgcatattacatgcaggg |
42550031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 45517335 - 45517290
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||| ||||| |
|
|
| T |
45517335 |
gtgagcttagttcagttggtagggatattgcattttatatacaggg |
45517290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 1151824 - 1151864
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
1151824 |
cggacactccacttcttcacaattaaattgtgtgagctcta |
1151864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 7166232 - 7166192
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
7166232 |
cggacactccacttctccacaatttaattgtgtgagctcta |
7166192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 7180619 - 7180579
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
7180619 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
7180579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 12048129 - 12048089
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
12048129 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
12048089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 12650389 - 12650349
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
12650389 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
12650349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 44 - 92
Target Start/End: Complemental strand, 12650456 - 12650408
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||| |||| |||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
12650456 |
tccccgtgaacttagctcagttggtaaggatattgcatgttatatgcag |
12650408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 16313773 - 16313729
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| |||| |||||||| ||||||||||||||||||||| |
|
|
| T |
16313773 |
gtgagcttaactcaattggtaggaatattgcatattatatgcagg |
16313729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 17776844 - 17776888
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
17776844 |
tgagtttagctcagttggtaggcatattgcattttatatgcaggg |
17776888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 54 - 94
Target Start/End: Complemental strand, 19063395 - 19063355
Alignment:
| Q |
54 |
cttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
19063395 |
cttagctcagttagtagagatattgcatattatatgcaggg |
19063355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 21265721 - 21265761
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
21265721 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
21265761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 22563451 - 22563491
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
22563451 |
cggacactccacttctccacaatttaattgtgtgagctcta |
22563491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 51 - 94
Target Start/End: Complemental strand, 26820726 - 26820682
Alignment:
| Q |
51 |
gagcttagctcagttggtagggatattgcata-ttatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
26820726 |
gagcttagctcagttggtagggatattgaatatttatatgcaggg |
26820682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 28564350 - 28564310
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
28564350 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
28564310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 37626231 - 37626179
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||| || |||||||||||| |
|
|
| T |
37626231 |
tatccccgtgagcttacctcagttggtagggatattatattttatatgcaggg |
37626179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 44019341 - 44019381
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
44019341 |
cggacactccacttctccacaatttaattgtgtgagctcta |
44019381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 45517273 - 45517233
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
45517273 |
cggacactccacttctccacaatttaattgtgtgagctcta |
45517233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 54 - 94
Target Start/End: Original strand, 51942303 - 51942343
Alignment:
| Q |
54 |
cttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51942303 |
cttaactcagttggtagggatattgcatattatatacaggg |
51942343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 94
Target Start/End: Original strand, 27233988 - 27234035
Alignment:
| Q |
47 |
ctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||| ||| |||||| | |||||||||||||||||||||| |
|
|
| T |
27233988 |
ctgtgagcttagttcaattggtatgaatattgcatattatatgcaggg |
27234035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 93
Target Start/End: Original strand, 31818598 - 31818641
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||| |||| ||||||||||||||||||||| |
|
|
| T |
31818598 |
tgagcttagttcagttgctaggaatattgcatattatatgcagg |
31818641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 136
Target Start/End: Complemental strand, 47930671 - 47930636
Alignment:
| Q |
101 |
accccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47930671 |
accccacttcttcacaattaaattgtgtgagctcta |
47930636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 99
Target Start/End: Original strand, 48643618 - 48643677
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgcagggacgga |
99 |
Q |
| |
|
|||||| | |||||||||| | || |||||| ||||||||||||||||||||||| |||| |
|
|
| T |
48643618 |
gatatctccgtgagcttagtttagctggtagagatattgcatattatatgcagggccgga |
48643677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 1247253 - 1247303
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||| |||||||| || |||||||||||| | ||||||||| |
|
|
| T |
1247253 |
tccctgtgagcttaactcagttgataaggatattgcataatttatgcaggg |
1247303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 6702643 - 6702681
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
6702643 |
gacactccacttcttcacaattaaattgtgtgagctcta |
6702681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 11215068 - 11215106
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
11215068 |
gacactccacttctccacaatttaattgtgtgagctcta |
11215106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 12662690 - 12662736
Alignment:
| Q |
49 |
gtgagcttagctcagttggta-gggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
12662690 |
gtgagcttagctcagttaataagggatattgcatattatatgcaggg |
12662736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 986 - 1048
Target Start/End: Complemental strand, 16498791 - 16498729
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataat |
1048 |
Q |
| |
|
|||||||| ||||||||||||||| || ||||||| |||||| | |||||||||||||||| |
|
|
| T |
16498791 |
tcattgtatctctctataaatagagctcatatgtaacctaattgcataccacaagagaataat |
16498729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Complemental strand, 18467201 - 18467163
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
18467201 |
gacactccacttctccacaatttaattgtgtgagctcta |
18467163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 21400084 - 21400042
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
21400084 |
gtgagcttagctcagttggtagggacaatgcataatatatgca |
21400042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 94
Target Start/End: Complemental strand, 28564409 - 28564367
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
28564409 |
agcttaactcagttagtagggatattgcagattatatgcaggg |
28564367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 29204648 - 29204690
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | |||||| |
|
|
| T |
29204648 |
gtgagcttagctcagttggtagggacattgcataatttatgca |
29204690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 94
Target Start/End: Complemental strand, 32970860 - 32970822
Alignment:
| Q |
56 |
tagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
32970860 |
tagctcagttgatagggatattgcattttatatgcaggg |
32970822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 33498486 - 33498412
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||| ||| | ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
33498486 |
tcattgtatttctctataaatggagcttatatgtaacctaattatacatcacaagagaataatataatcctcttt |
33498412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 38032201 - 38032251
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||| ||||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
38032201 |
atccccgtgaacttagatcagctggtagggatattgcatattgtatgcagg |
38032251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 41763216 - 41763174
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
41763216 |
gtgagcttagctcagttggtagggataatgcataaaatatgca |
41763174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Complemental strand, 45333715 - 45333677
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
45333715 |
gacactccacttctccacaatttaattgtgtgagctcta |
45333677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 47469145 - 47469095
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| |||||||| | ||||||||| |
|
|
| T |
47469145 |
tccccgtgagcttagctcagttggcagggacattgcataatttatgcaggg |
47469095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 89
Target Start/End: Original strand, 52773322 - 52773368
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| |||||||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
52773322 |
atcccggtgagcttagctcacttggtgggaatattgcatattatatg |
52773368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 11333667 - 11333712
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||| | ||||||||| |
|
|
| T |
11333667 |
gtgaacttagctcagttggtagggacattgcataatttatgcaggg |
11333712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 11491688 - 11491733
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||| | ||||||||| |
|
|
| T |
11491688 |
gtgaacttagctcagttggtagggacattgcataatttatgcaggg |
11491733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 48 - 81
Target Start/End: Complemental strand, 12396319 - 12396286
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcat |
81 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
12396319 |
tgtgagcttaactcagttggtagggatattgcat |
12396286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 16997326 - 16997281
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||| || | |||||||| ||||||||| |
|
|
| T |
16997326 |
gtgagcttagctcagttggtagagacaatgcatattttatgcaggg |
16997281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 18607876 - 18607831
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| | ||||||||| |
|
|
| T |
18607876 |
gtgagcttagctgagttggtagggacattgcataatttatgcaggg |
18607831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 24874141 - 24874186
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| | ||||||||| |
|
|
| T |
24874141 |
gtgagcttagctcagttgatagggacattgcataatttatgcaggg |
24874186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 27178775 - 27178730
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
27178775 |
gtgagcttaactcaattggtaaggatattgtatattatatgcaggg |
27178730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 27579541 - 27579496
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||| ||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
27579541 |
gtgaacttaactcagttggtatggatattacatattatatgcaggg |
27579496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 80
Target Start/End: Original strand, 34180668 - 34180697
Alignment:
| Q |
51 |
gagcttagctcagttggtagggatattgca |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34180668 |
gagcttagctcagttggtagggatattgca |
34180697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 34656462 - 34656417
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||| ||| |||||||||| |||||||||||| |
|
|
| T |
34656462 |
gtgagtttagctcagttgatagagatattgcattttatatgcaggg |
34656417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 136
Target Start/End: Original strand, 35283569 - 35283606
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
35283569 |
acactccacttctccacaatttaattgtgtgagctcta |
35283606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 136
Target Start/End: Complemental strand, 35605625 - 35605588
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
35605625 |
acaccccacttctccacaattaaattgtgtgagctcta |
35605588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 43021689 - 43021644
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||| |||||||||||| | |||||||| ||||||||| |
|
|
| T |
43021689 |
gtgagcttagcttagttggtagggacaatgcatattttatgcaggg |
43021644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 59 - 92
Target Start/End: Complemental strand, 49425035 - 49425002
Alignment:
| Q |
59 |
ctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
49425035 |
ctcaattggtagggatattgcatattatatgcag |
49425002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 81; Significance: 1e-37; HSPs: 167)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 857 - 1054
Target Start/End: Complemental strand, 23690489 - 23690292
Alignment:
| Q |
857 |
atttatttgttatgaatataacaagtggatgtccataaacccttgtatttatctcttaagtgacaacatattacttttcttttaagtcacacctatttgt |
956 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||| | ||||| ||||| ||||||||||||||||| ||||||||||| |||||||||| |||| || |
|
|
| T |
23690489 |
atttttttgttatgaatataataagtggatgtcgacaaacctttgtacttatctcttaagtgacatcatattactttatccctaagtcacacatattcgt |
23690390 |
T |
 |
| Q |
957 |
atttattcttacttaactcttaagtcatatcattgtacttctct---ataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaat |
1053 |
Q |
| |
|
| |||| | ||||||| |||| ||||||||||||| |||||| ||||||||||||||||||||||||||||||||| ||||| | |||||| |||| |
|
|
| T |
23690389 |
acttatcc---cttaactgttaaatcatatcattgtatttctctataataaatagagaccacatgtaacataattgtacatcacaacacaataatataat |
23690293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 9e-36
Query Start/End: Original strand, 913 - 1077
Target Start/End: Original strand, 23775198 - 23775366
Alignment:
| Q |
913 |
taagtgacaacatattacttttcttttaagtcacacctatttgtatttattct-----tacttaactcttaagtcatatcattgtacttctctataaata |
1007 |
Q |
| |
|
||||||||| ||||||| || | ||||||||||||| ||||||||||||| || ||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
23775198 |
taagtgacatcatattatttattttttaagtcacacatatttgtatttatcctttaagtacttaacttttaa-tcatatcattgtacttctctataaata |
23775296 |
T |
 |
| Q |
1008 |
gagaccacatgtaacataattgtacaccacaagagaataatgtaatcatctttgtttctctctgcttctc |
1077 |
Q |
| |
|
|||| ||||||||| ||||||||||| || ||||||||| | |||||||||| ||||||||| |||||| |
|
|
| T |
23775297 |
gagatcacatgtaagataattgtacatcagaagagaatattaaaatcatctttctttctctctccttctc |
23775366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 78; E-Value: 9e-36
Query Start/End: Original strand, 913 - 1077
Target Start/End: Original strand, 23862152 - 23862320
Alignment:
| Q |
913 |
taagtgacaacatattacttttcttttaagtcacacctatttgtatttattct-----tacttaactcttaagtcatatcattgtacttctctataaata |
1007 |
Q |
| |
|
||||||||| ||||||| || | ||||||||||||| ||||||||||||| || ||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
23862152 |
taagtgacatcatattatttattttttaagtcacacatatttgtatttatcctttaagtacttaacttttaa-tcatatcattgtacttctctataaata |
23862250 |
T |
 |
| Q |
1008 |
gagaccacatgtaacataattgtacaccacaagagaataatgtaatcatctttgtttctctctgcttctc |
1077 |
Q |
| |
|
|||| ||||||||| ||||||||||| || ||||||||| | |||||||||| ||||||||| |||||| |
|
|
| T |
23862251 |
gagatcacatgtaagataattgtacatcagaagagaatattaaaatcatctttctttctctctccttctc |
23862320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 70; E-Value: 5e-31
Query Start/End: Original strand, 866 - 1053
Target Start/End: Complemental strand, 26459480 - 26459290
Alignment:
| Q |
866 |
ttatgaatataacaagtggatgtccataaacccttgtatttatctcttaagtgacaacatattacttttcttttaagtcacacctatttgtatttattc- |
964 |
Q |
| |
|
|||||||||| | ||||||||||||| ||||||||||| ||||||||||||||| | || |||||| ||| |||||||||| | ||||| |||| | |
|
|
| T |
26459480 |
ttatgaatatcaaaagtggatgtccacaaacccttgtacttatctcttaagtgaaatgattttacttatctcctaagtcacacttttttgt--ttatccc |
26459383 |
T |
 |
| Q |
965 |
----ttacttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaat |
1053 |
Q |
| |
|
||||||||||||| ||| |||||||||||| |||| ||||||||||| ||||||||| |||||||||||| |||||| |||||| |||| |
|
|
| T |
26459382 |
ttaattacttaactcttgagtaatatcattgtacgtctccataaatagagatcacatgtaatataattgtacactacaagaaaataatataat |
26459290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 68; E-Value: 8e-30
Query Start/End: Original strand, 862 - 1054
Target Start/End: Complemental strand, 23695523 - 23695331
Alignment:
| Q |
862 |
tttgttatgaatataacaagtggatgtccataaacccttgtatttatctcttaagtgacaacatattacttttcttttaagtcacacctatttgtattta |
961 |
Q |
| |
|
||||||||| |||||| ||||||||||||| ||||| |||| || |||||||||||| | ||||||||||| |||||||||| |||| ||| ||| |
|
|
| T |
23695523 |
tttgttatgtatataataagtggatgtccacaaacctttgtccttgtctcttaagtgaaatcatattactttatccctaagtcacacatattcgtactta |
23695424 |
T |
 |
| Q |
962 |
ttcttacttaactcttaagtcatatcattgtacttctctataa---atagagaccacatgtaacataattgtacaccacaagagaataatgtaatc |
1054 |
Q |
| |
|
| | | ||||| |||||||||||||||||| |||||||||| |||| |||||||||||||||||||||||| ||||||| |||||| ||||| |
|
|
| T |
23695423 |
tcc---cataactgttaagtcatatcattgtatttctctataataaatagtgaccacatgtaacataattgtacatcacaagaaaataatataatc |
23695331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 48 - 136
Target Start/End: Original strand, 29045889 - 29045974
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcagggacggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||| |||||| | |||||| |||||||||||||||||||||||| |
|
|
| T |
29045889 |
tgtgagtttagttcagttggtagggatattgcatattatatgcagg---ggacactcgacttctccacaatttaattgtgtgagctcta |
29045974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 17545247 - 17545194
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17545247 |
atatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
17545194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 966 - 1053
Target Start/End: Complemental strand, 54524 - 54437
Alignment:
| Q |
966 |
tacttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaat |
1053 |
Q |
| |
|
|||||||||| |||||||||| |||||| |||| ||||||||||| ||||||||||| ||||||||| |||||| ||||||| |||| |
|
|
| T |
54524 |
tacttaactcataagtcatattattgtatttctatataaatagagttcacatgtaacacaattgtacaacacaagtgaataatataat |
54437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 1743123 - 1743174
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1743123 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
1743174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 4417759 - 4417708
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4417759 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
4417708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 11897244 - 11897295
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11897244 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
11897295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 27765253 - 27765304
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27765253 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
27765304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 42320313 - 42320364
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42320313 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
42320364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 6518849 - 6518799
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6518849 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
6518799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 9835030 - 9835080
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9835030 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
9835080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 12463753 - 12463803
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12463753 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
12463803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 42 - 92
Target Start/End: Original strand, 16603394 - 16603444
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16603394 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcag |
16603444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 21918049 - 21918099
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21918049 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
21918099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 41 - 91
Target Start/End: Original strand, 27798616 - 27798666
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27798616 |
atatccctgtgagcatagctcagttggtagggatattgcatattatatgca |
27798666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 32505685 - 32505735
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32505685 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
32505735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 41179876 - 41179826
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41179876 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
41179826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 6558796 - 6558849
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6558796 |
atatccccgtgagcttagctcaattggtagggatattgcatattatatgcaggg |
6558849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 12891552 - 12891605
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12891552 |
atatccccgtgagcttagctcagttggtagggatattgcatattatatgtaggg |
12891605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 8968752 - 8968796
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8968752 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
8968796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 9125659 - 9125711
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9125659 |
tatccccgtgagcttagctcagttggtagcgatattgcatattatatgcaggg |
9125711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 13622020 - 13621968
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13622020 |
tatccccgtgagcttagctcagttggtagggatatcgcatattatatgcaggg |
13621968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 25648160 - 25648108
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25648160 |
atatccccgtgagcttagctcagttggtagggatattgcatattacatgcagg |
25648108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 35515515 - 35515559
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35515515 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
35515559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 39919168 - 39919116
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39919168 |
atatccccgtgagcttagcttagttggtagggatattgcatattatatgcagg |
39919116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 5900289 - 5900340
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5900289 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggg |
5900340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 50 - 93
Target Start/End: Complemental strand, 16386807 - 16386764
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16386807 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
16386764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 49 - 92
Target Start/End: Complemental strand, 25472650 - 25472607
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25472650 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
25472607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 2328589 - 2328639
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2328589 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgcagg |
2328639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 5966826 - 5966876
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5966826 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
5966876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 12767961 - 12768011
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12767961 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcagg |
12768011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 18815345 - 18815395
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18815345 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatgcagg |
18815395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 21749450 - 21749400
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21749450 |
atccccgtgagcttagctcagttggtagggatactgcatattatatgcagg |
21749400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 36888468 - 36888418
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36888468 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcagg |
36888418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 42525397 - 42525447
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42525397 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcagg |
42525447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 546805 - 546850
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
546805 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggg |
546850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 2362972 - 2363017
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2362972 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggg |
2363017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 42 - 91
Target Start/End: Original strand, 2848209 - 2848258
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2848209 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatgca |
2848258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 6414071 - 6414116
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6414071 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggg |
6414116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 50 - 91
Target Start/End: Original strand, 8241054 - 8241095
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8241054 |
tgagcttagctcagttggtagggatattgcatattatatgca |
8241095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 10241728 - 10241773
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10241728 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggg |
10241773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 17666009 - 17666054
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17666009 |
gtgagcttagctcagttggtaggaatattgcatattatatgcaggg |
17666054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 43 - 88
Target Start/End: Complemental strand, 22569317 - 22569272
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22569317 |
atccctgtgagcttagctcagttggtaggcatattgcatattatat |
22569272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 23292484 - 23292439
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23292484 |
gtgagcttagctcagttggtagggatattgcatgttatatgcaggg |
23292439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 48 - 93
Target Start/End: Complemental strand, 25400435 - 25400390
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25400435 |
tgtgagcatagctcagttggtagggatattgcatattatatgcagg |
25400390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 29713449 - 29713400
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29713449 |
atccccgtgagcttagctcagttggtagggatattgcctattatatgcag |
29713400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 89
Target Start/End: Complemental strand, 4745943 - 4745903
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4745943 |
gtgagcttagctcagttggtagggatattgcatattatatg |
4745903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 8478967 - 8478915
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8478967 |
tatccccgtgagtttagttcagttggtagggatattgcatattatatgcaggg |
8478915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 25729514 - 25729462
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
25729514 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggg |
25729462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 33736088 - 33736036
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| | ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33736088 |
tatccccgggagcttaactcagttggtagggatattgcatattatatgcaggg |
33736036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 43 - 91
Target Start/End: Original strand, 40091474 - 40091522
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40091474 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgca |
40091522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 41477432 - 41477380
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
41477432 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggg |
41477380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 42916385 - 42916437
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
42916385 |
tatccccgtgagcttagctcagttggtagggatattgtatgttatatgcaggg |
42916437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 43580881 - 43580925
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43580881 |
gtgaacttagctcagttggtagggatattgcatattatatgcagg |
43580925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 831589 - 831640
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
831589 |
atccccgtgagcttagctctgttggtagggatatttcatattatatgcaggg |
831640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 1269240 - 1269189
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
1269240 |
atccccgtgagcttagctcaattggtagagatattgcatattatatgcaggg |
1269189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 11774533 - 11774482
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11774533 |
tatccccgtgaccttagctcagtttgtagggatattgcatattatatgcagg |
11774482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 15241393 - 15241444
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
15241393 |
atccccgtgagcttagctcagttgataggaatattgcatattatatgcaggg |
15241444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 51 - 94
Target Start/End: Original strand, 24033082 - 24033125
Alignment:
| Q |
51 |
gagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24033082 |
gagcttagctcagttggtagggatattgcattttatatgcaggg |
24033125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 89
Target Start/End: Complemental strand, 39886286 - 39886239
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39886286 |
tatccccgtgagcatagctcagttggtagggatattgcatattatatg |
39886239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 3198325 - 3198375
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
3198325 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgcaggg |
3198375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Original strand, 6119863 - 6119909
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
6119863 |
cctgtgagcttagctcagttggaagggatattgcattttatatgcag |
6119909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 48 - 94
Target Start/End: Original strand, 18928722 - 18928768
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
18928722 |
tgtgagcttagctcagttggtagggatattgcataatttatgcaggg |
18928768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 49 - 95
Target Start/End: Original strand, 19985503 - 19985549
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19985503 |
gtgaccttagctcagttggtagggatattgcataatatatgcaggga |
19985549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 28367048 - 28366974
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
28367048 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcctcttt |
28366974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 28375788 - 28375714
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
28375788 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcttcttt |
28375714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 47 - 89
Target Start/End: Original strand, 29154844 - 29154886
Alignment:
| Q |
47 |
ctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29154844 |
ctgtgagcttagctcagttggtagggatagtgcatattatatg |
29154886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 56 - 94
Target Start/End: Original strand, 30571164 - 30571202
Alignment:
| Q |
56 |
tagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30571164 |
tagctcagttggtagggatattgcatattatatgcaggg |
30571202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 89
Target Start/End: Original strand, 32706319 - 32706365
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32706319 |
atccccgtgagcttagctcagttggtagggatattacatattatatg |
32706365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 50 - 96
Target Start/End: Complemental strand, 36716924 - 36716878
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36716924 |
tgagcttaactcagctggtagggatattgcatattatatgcagggac |
36716878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 40361646 - 40361604
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40361646 |
gtgagtttagctcagttggtagggatattgcatattatatgca |
40361604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 45 - 94
Target Start/End: Complemental strand, 4238379 - 4238330
Alignment:
| Q |
45 |
ccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
4238379 |
ccctgtgagtttagttcagttggtatggatattgcatattatatgcaggg |
4238330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 8750968 - 8750923
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
8750968 |
gtgagcttagttaagttggtagggatattgcatattatatgcaggg |
8750923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 52 - 93
Target Start/End: Original strand, 10404133 - 10404174
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10404133 |
agcttagctcagttggtaggaatattgcatattatatgcagg |
10404174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 11188749 - 11188704
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
11188749 |
gtgagcttagctcagttgataggaatattgcatattatatgcaggg |
11188704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 11786127 - 11786082
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11786127 |
gtgagcttaactcagttggtagggatattgcattttatatgcaggg |
11786082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 16891349 - 16891394
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
16891349 |
gtgagcttagctcagttggtagggatattgcattttatatacaggg |
16891394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 17064925 - 17064880
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17064925 |
gtgagcttaactcaattggtagggatattgcatattatatgcaggg |
17064880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 58 - 136
Target Start/End: Complemental strand, 19273260 - 19273178
Alignment:
| Q |
58 |
gctcagttggtagggatattgcatattatatgcagggac----ggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| | | |||||||||||| || |||| |||||||||||||||| |
|
|
| T |
19273260 |
gctcagttggtagggatattgcatgttatatgcaggggccggggttcaccccacttctccataattaaattgtgtgagctcta |
19273178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 35113029 - 35112984
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35113029 |
gtgagcttagttcagttgatagggatattgcatattatatgcaggg |
35112984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 35241399 - 35241444
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35241399 |
gtgagcttagttcagttggtagagatattgcatattatatgcaggg |
35241444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 36124402 - 36124447
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
36124402 |
gtgagcttagctcagttgataggaatattgcatattatatgcaggg |
36124447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 40276509 - 40276464
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40276509 |
gtgagtttagctcagttggtaggaatattgcatattatatgcaggg |
40276464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 6526046 - 6526098
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||| |||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
6526046 |
tatccccgtgagtttagctcagttggtagagatattggatattatatgcaggg |
6526098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 14641176 - 14641132
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
14641176 |
gtgagcttaactcaattggtagggatattgcatattatatgcagg |
14641132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 55 - 91
Target Start/End: Original strand, 28308243 - 28308279
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28308243 |
ttagctcagttggtagggatattgcatattatatgca |
28308279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 39165020 - 39165064
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39165020 |
gtgagtttagttcagttggtagggatattgcatattatatgcagg |
39165064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 988711 - 988762
Alignment:
| Q |
43 |
atccctgtgagcttagctcagtt-ggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
988711 |
atccccgtgagcttaactcagtttggtagggatattgcatattatatgcagg |
988762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 16971618 - 16971669
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
16971618 |
tatccccgtgagcttagctcagttggtagagatattgtatattataggcagg |
16971669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 94
Target Start/End: Original strand, 18638603 - 18638646
Alignment:
| Q |
51 |
gagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
18638603 |
gagcttagctcagttggtagggatatcgcattttatatgcaggg |
18638646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 24132934 - 24132985
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||| ||| |||||||| |||||||||||||| |
|
|
| T |
24132934 |
atccccgtgagcttagctcagttgatagagatattgcgtattatatgcaggg |
24132985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 26912830 - 26912881
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||||||||||||||||| |||| |
|
|
| T |
26912830 |
atccccgtgagcttaactcaattggtagggatattgcatattatatgtaggg |
26912881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 30963239 - 30963167
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| | ||| |||| ||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
30963239 |
tcattgtatttctctataaatagag--ctcatataacttaattatacatcacaagagaataatataatcatcttt |
30963167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 32423562 - 32423613
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
32423562 |
atccccgtgagcttaactcagttgttagggatattgtatattatatgcaggg |
32423613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 40081875 - 40081926
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||| ||| |||||||||||| |
|
|
| T |
40081875 |
atccccgtgagcttagctcagttggtagagatattacatcttatatgcaggg |
40081926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 48 - 95
Target Start/End: Complemental strand, 40098802 - 40098755
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||| |||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
40098802 |
tgtgggcttagctcagttgttaggaatattgcatattatatgcaggga |
40098755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 50 - 93
Target Start/End: Original strand, 41156332 - 41156375
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
41156332 |
tgagcttagctcggttgatagggatattgcatattatatgcagg |
41156375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 58 - 93
Target Start/End: Complemental strand, 42718879 - 42718844
Alignment:
| Q |
58 |
gctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42718879 |
gctcagttggtagggatattgcatattatatgcagg |
42718844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 2363037 - 2363075
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2363037 |
gacactccacttcttcacaatttaattgtgtgagctcta |
2363075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 42 - 92
Target Start/End: Complemental strand, 3712140 - 3712090
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||| || ||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
3712140 |
tatccccgtaagcttagctcagttggtagagatattgcattttatatgcag |
3712090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 4067980 - 4068030
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||||||||||| | |||||||| ||||||||| |
|
|
| T |
4067980 |
tccccgtgagcttagctcagttggtagggacaatgcatattttatgcaggg |
4068030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 43 - 136
Target Start/End: Original strand, 11795504 - 11795598
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgc-agggacggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| | | | | ||||||| |||||||| ||||||| |||||||||||||||| |
|
|
| T |
11795504 |
atccctgtgagcttagctcagttggtagggatatgacatatgaggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
11795598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 40 - 94
Target Start/End: Original strand, 20719732 - 20719786
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||| |||||||||| || ||||||||||||||||||| ||||||| |||| |
|
|
| T |
20719732 |
gatatccccgtgagcttagatctgttggtagggatattgcattttatatgtaggg |
20719786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 48 - 94
Target Start/End: Complemental strand, 22229030 - 22228984
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
22229030 |
tgtgagtttagctcagttggtatggatattgcatgttatatgcaggg |
22228984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 39028100 - 39028058
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39028100 |
gtgagattagctcatttggtagggatattgcatattatatgca |
39028058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 1670397 - 1670442
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1670397 |
gtgagcttatatcagttggtagggatatggcatattatatgcaggg |
1670442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 4393859 - 4393904
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||| |||||||||||| |
|
|
| T |
4393859 |
gtgagcttagttcagttggtagggatgttgcattttatatgcaggg |
4393904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 99 - 136
Target Start/End: Complemental strand, 8478895 - 8478858
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8478895 |
acactccacttcttcacaatttaattgtgtgagctcta |
8478858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 19891493 - 19891448
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
19891493 |
gtgagcttaactcagttggtaaggatattgcattttatatgcaggg |
19891448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 24477828 - 24477873
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
24477828 |
gtgagcttagctcagttggtagggacgttgcataatatatgcaggg |
24477873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 27241644 - 27241689
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||| ||||| ||||| |||||||||||||||| |
|
|
| T |
27241644 |
gtgagcttagctcagtttgtaggaatattacatattatatgcaggg |
27241689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 985 - 1058
Target Start/End: Complemental strand, 34648002 - 34647929
Alignment:
| Q |
985 |
atcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatct |
1058 |
Q |
| |
|
||||||||| |||| ||||||| ||| || ||||||| |||||||||| |||||||||||||| |||||||| |
|
|
| T |
34648002 |
atcattgtatttctgtataaattgagctcatatgtaacctaattgtacatcacaagagaataatagaatcatct |
34647929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 89
Target Start/End: Original strand, 1469728 - 1469768
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
1469728 |
gtgagtttagctcagttggtagagatattgcatattatatg |
1469768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 15241461 - 15241501
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
15241461 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
15241501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 16789135 - 16789175
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
16789135 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
16789175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 50 - 94
Target Start/End: Complemental strand, 17175117 - 17175073
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17175117 |
tgagtttaactcagttggtagggatattgcatgttatatgcaggg |
17175073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 18050244 - 18050284
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
18050244 |
cggacactccacttctccacaatttaattgtgtgagctcta |
18050284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 41 - 93
Target Start/End: Original strand, 37034801 - 37034853
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
37034801 |
atatccccatgagcttagctcaattggtagggatatcgcattttatatgcagg |
37034853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 47 - 95
Target Start/End: Complemental strand, 38642266 - 38642218
Alignment:
| Q |
47 |
ctgtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
||||||| |||||| |||||||||| ||||| ||||||||||||||||| |
|
|
| T |
38642266 |
ctgtgagtttagcttagttggtaggaatattacatattatatgcaggga |
38642218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 89
Target Start/End: Original strand, 42885832 - 42885872
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
42885832 |
gtgagcttagctaagttggtagagatattgcatattatatg |
42885872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 11146602 - 11146551
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||| || ||||||||||| ||||||| |||| |
|
|
| T |
11146602 |
atccccgtgagcttagctcagttgataaggatattgcatgttatatgtaggg |
11146551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 88
Target Start/End: Complemental strand, 20370191 - 20370152
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
20370191 |
gtgagcttagctcagttggtagggataatgcataatatat |
20370152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 21962178 - 21962131
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
||||| ||||||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
21962178 |
atccccgtgagcttaactcagttggcagggatattgcaaattatatgc |
21962131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 136
Target Start/End: Original strand, 29691423 - 29691462
Alignment:
| Q |
97 |
ggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
29691423 |
ggacaccccacttctccacaattaaattgtgtgagctcta |
29691462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 30927448 - 30927376
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| | ||| |||| ||||| |||| ||||| |||||||| ||||||||||| |
|
|
| T |
30927448 |
tcattgtatttctctataaatagag--ctcatataacttaattatacatcacaaaagaataatataatcatcttt |
30927376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 33433992 - 33433941
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||| ||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
33433992 |
atccccgtgaacttagctcagttggtagaaatattgcatattatatacaggg |
33433941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 59 - 94
Target Start/End: Original strand, 38097285 - 38097320
Alignment:
| Q |
59 |
ctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38097285 |
ctcagttggtatggatattgcatattatatgcaggg |
38097320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 88
Target Start/End: Original strand, 42158885 - 42158924
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
42158885 |
gtgaacttagctcagtttgtagggatattgcatattatat |
42158924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 83
Target Start/End: Original strand, 42317405 - 42317436
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatat |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42317405 |
agcttagctcagttggtagggatattgcatat |
42317436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 88
Target Start/End: Complemental strand, 42842943 - 42842904
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
42842943 |
gtgagcttagctcagttggtagagatattgtatattatat |
42842904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 5485186 - 5485228
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
5485186 |
gtgagcttagctcagttggtagggacaatgcataatatatgca |
5485228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 6489007 - 6489049
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
6489007 |
gtgagcttagctcagttggtagggacaatgcataatatatgca |
6489049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 7143417 - 7143459
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||| ||| ||||||||||||||| |||||||||||| |
|
|
| T |
7143417 |
gtgagcttagttcaattggtagggatattgtatattatatgca |
7143459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 11017176 - 11017218
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
11017176 |
gtgagtttagctcagttggtagggataatgcataatatatgca |
11017218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 95
Target Start/End: Complemental strand, 12677225 - 12677183
Alignment:
| Q |
53 |
gcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||||||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
12677225 |
gcttagctcaattggtaggaatattacatattatatgcaggga |
12677183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 15889411 - 15889453
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
15889411 |
gtgagcttagctcagttggtagggacaatgcataatatatgca |
15889453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 17210770 - 17210728
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
17210770 |
gtgagcttagctcagttggtagggacagtgcataatatatgca |
17210728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 85
Target Start/End: Complemental strand, 18993534 - 18993492
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatatta |
85 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
18993534 |
atccccgtgagcttagctcagttgatagggatattacatatta |
18993492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 88
Target Start/End: Original strand, 28581181 - 28581227
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
||||| |||||||||| || | ||||||||||||||||||||||||| |
|
|
| T |
28581181 |
tatccttgtgagcttaacttaattggtagggatattgcatattatat |
28581227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 89
Target Start/End: Complemental strand, 31074200 - 31074154
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||| ||| ||||||| |
|
|
| T |
31074200 |
atccccgtgagcttaactcagttggtagggatattacattttatatg |
31074154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 31591598 - 31591556
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||| | | ||||||||||||||| |
|
|
| T |
31591598 |
gtgagcttagctcagttggtaggaacaatgcatattatatgca |
31591556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 55 - 89
Target Start/End: Complemental strand, 32389695 - 32389661
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
32389695 |
ttagctcagttggtagagatattgcatattatatg |
32389661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 87
Target Start/End: Complemental strand, 32392193 - 32392155
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattata |
87 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
32392193 |
gtgaacttagcttagttggtagggatattgcatattata |
32392155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 34436851 - 34436893
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
34436851 |
gtgagcttagctcagttggtagggacaatgcataatatatgca |
34436893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 136
Target Start/End: Original strand, 546870 - 546907
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
546870 |
acatcccacttcttcacaattaaattgtgtgagctcta |
546907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 2474764 - 2474809
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||| |||||||| ||||||||||||||| |||||||| |
|
|
| T |
2474764 |
gtgagtttagcttagttggtaaggatattgcatattacatgcaggg |
2474809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 3515532 - 3515487
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
3515532 |
gtgagtttagctcagttgacagggatattgcgtattatatgcaggg |
3515487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 48 - 89
Target Start/End: Original strand, 4153549 - 4153590
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
4153549 |
tgtgaacttaactcagttggtagggatattgcattttatatg |
4153590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 59 - 92
Target Start/End: Complemental strand, 7845070 - 7845037
Alignment:
| Q |
59 |
ctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
7845070 |
ctcagttgctagggatattgcatattatatgcag |
7845037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 9688745 - 9688696
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||| |||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
9688745 |
atccccgtgagcttagcttagtttgtagaaatattgcatattatatgcag |
9688696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 13876394 - 13876345
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||||| ||||||||||| ||| ||| ||||||| ||||||||||||| |
|
|
| T |
13876394 |
atccctgtcagcttagctcaattgatagagatattgtatattatatgcag |
13876345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 82
Target Start/End: Complemental strand, 18049688 - 18049655
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcata |
82 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
18049688 |
gtgagcttagctcaattggtagggatattgcata |
18049655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 18473810 - 18473855
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||| | ||||||||||||| ||||||||||||||| |
|
|
| T |
18473810 |
gtgagcttaactcaatcggtagggatattgtatattatatgcaggg |
18473855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 88
Target Start/End: Original strand, 18597410 - 18597451
Alignment:
| Q |
47 |
ctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
||||||| |||| ||| ||||||||||||||||||||||||| |
|
|
| T |
18597410 |
ctgtgagtttagttcaattggtagggatattgcatattatat |
18597451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 50 - 91
Target Start/End: Complemental strand, 19068499 - 19068458
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
19068499 |
tgagcttagctcagttggtatggataatgcataatatatgca |
19068458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 82
Target Start/End: Original strand, 27498587 - 27498620
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcata |
82 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
27498587 |
gtgagcttagctcggttggtagggatattgcata |
27498620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 43 - 76
Target Start/End: Original strand, 31581530 - 31581563
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatat |
76 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
31581530 |
atccctgtgagcttagctcagttggtaggaatat |
31581563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 31920839 - 31920802
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatat |
83 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||| |
|
|
| T |
31920839 |
cctgtgagcttaacttagttggtagggatattgcatat |
31920802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 91
Target Start/End: Original strand, 39780802 - 39780851
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||| |||||| ||||||| ||| |||||||||||||| ||||||||| |
|
|
| T |
39780802 |
tatccccgtgagcgtagctcaattgctagggatattgcattttatatgca |
39780851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 39800097 - 39800052
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| | ||||||||| |
|
|
| T |
39800097 |
gtgagcttagctcagttggtagggacaatgcataatttatgcaggg |
39800052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 61 - 94
Target Start/End: Complemental strand, 41319506 - 41319473
Alignment:
| Q |
61 |
cagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
41319506 |
cagttggtagggatattgcattttatatgcaggg |
41319473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 41930108 - 41930153
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||| |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
41930108 |
gtgaacttaactcagttgatagggatattgcattttatatgcaggg |
41930153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 133
Target Start/End: Original strand, 42916454 - 42916491
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagct |
133 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
42916454 |
cggacaccccacttctccacaattaaattgtgtgagct |
42916491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 66; Significance: 1e-28; HSPs: 136)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 885 - 1058
Target Start/End: Original strand, 31023294 - 31023472
Alignment:
| Q |
885 |
atgtccataaacccttgtatttatctcttaagtgacaacatattacttttcttttaagtcacacctatttgtatttat-tct----tacttaactcttaa |
979 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||| |||| |||||| |||| ||||| | || | ||| |||| || ||| || |||||||||| |
|
|
| T |
31023294 |
atgtccagaaacccttgtacttatctcttaagtgacgacatgttacttatcttctaagttaaacatgtttttattaatctctcgagtatctaactcttaa |
31023393 |
T |
 |
| Q |
980 |
gtcatatcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatct |
1058 |
Q |
| |
|
|||||||||||||| |||| |||||||||||| ||||||||||||||||||| | |||| || |||||| ||||||||| |
|
|
| T |
31023394 |
gtcatatcattgtagttctatataaatagagatcacatgtaacataattgtatatcacatgaaaataatataatcatct |
31023472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 28030860 - 28030912
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28030860 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
28030912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 7545324 - 7545377
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7545324 |
atatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
7545377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 40 - 93
Target Start/End: Original strand, 10934593 - 10934646
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10934593 |
gatatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
10934646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 15091443 - 15091496
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15091443 |
atatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
15091496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 7865429 - 7865377
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7865429 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
7865377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 9435622 - 9435674
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9435622 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
9435674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 4408355 - 4408406
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4408355 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
4408406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 9246456 - 9246405
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9246456 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
9246405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 9372274 - 9372223
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9372274 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
9372223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 33573813 - 33573864
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33573813 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
33573864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 3794246 - 3794196
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3794246 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
3794196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 7207841 - 7207891
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7207841 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
7207891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 17441912 - 17441862
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17441912 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
17441862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 19953901 - 19953851
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19953901 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
19953851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 3294767 - 3294812
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3294767 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
3294812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 8439678 - 8439723
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8439678 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
8439723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 30885645 - 30885592
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30885645 |
atatccccgtgagcttagctcagttggtagggatattgcatattatatacaggg |
30885592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 41 - 93
Target Start/End: Original strand, 361158 - 361210
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
361158 |
atatccatgtgagcttaactcagttggtagggatattgcatattatatgcagg |
361210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 1968992 - 1969044
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1968992 |
tatccccgtgagcttagctcagttggtagggatattacatattatatgcaggg |
1969044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 6210050 - 6210102
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6210050 |
tatccccgtgaacttagctcagttggtagggatattgcatattatatgcaggg |
6210102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 43 - 136
Target Start/End: Original strand, 8857087 - 8857188
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg--------acggacaccccacttcttcacaatttaattgtgtgagctc |
134 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||| || || |||||||||| ||||||| |||||||||||||| |
|
|
| T |
8857087 |
atccccgtgagcttagctcagttggtagggatattacatattatatgcaggggccggggttcgaaccccccacttctccacaattaaattgtgtgagctc |
8857186 |
T |
 |
| Q |
135 |
ta |
136 |
Q |
| |
|
|| |
|
|
| T |
8857187 |
ta |
8857188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 31935095 - 31935147
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31935095 |
tatctctgtgagcttagctcagttggtagggatattgcattttatatgcaggg |
31935147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 607184 - 607231
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
607184 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
607231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 4661093 - 4661144
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4661093 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgcaggg |
4661144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 9704413 - 9704464
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9704413 |
tatccccgtgaacttagctcagttggtagggatattgcatattatatgcagg |
9704464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 27094880 - 27094829
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27094880 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggg |
27094829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 31802049 - 31802100
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31802049 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
31802100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 50 - 93
Target Start/End: Complemental strand, 32611620 - 32611577
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32611620 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
32611577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 2251841 - 2251886
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2251841 |
gtgagcttagctcagttggtagggatattgcatactatatgcaggg |
2251886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 4869765 - 4869720
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4869765 |
gtgagcttagctcagttggtagggatactgcatattatatgcaggg |
4869720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 10517194 - 10517247
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
10517194 |
atatccccgtgagcttagctcagttggtatggatattgcattttatatgcaggg |
10517247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 32166372 - 32166417
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32166372 |
gtgagcttagctcaattggtagggatattgcatattatatgcaggg |
32166417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 216202 - 216254
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
216202 |
tatcccagtgagcttagctcaattggtagggatattgcatgttatatgcaggg |
216254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 743566 - 743610
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
743566 |
gtgagcttagctcagttggtagggatattgcatattagatgcagg |
743610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 7177291 - 7177343
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
7177291 |
tatccccgtgagcttagctcagttggtagggatattgtattttatatgcaggg |
7177343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 10483610 - 10483558
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10483610 |
tatccccgtgatcttagctcagttggtagggatattgcattttatatgcaggg |
10483558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 43 - 91
Target Start/End: Original strand, 13732809 - 13732857
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13732809 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgca |
13732857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 50 - 94
Target Start/End: Complemental strand, 15964009 - 15963965
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15964009 |
tgagcttagctcagttggtagggatattgcatattttatgcaggg |
15963965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 19374914 - 19374862
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
19374914 |
tatccccgtgagcttagctcagttagtaggaatattgcatattatatgcaggg |
19374862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 22574866 - 22574918
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
22574866 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggg |
22574918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 28237319 - 28237275
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28237319 |
gtgagcttaactcagttggtagggatattgcatattatatgcagg |
28237275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 40 - 92
Target Start/End: Complemental strand, 34432873 - 34432821
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||| || |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34432873 |
gatattcccgtgagcttagttcagttggtagggatattgcatattatatgcag |
34432821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 978207 - 978156
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
978207 |
atccccgtgagtttagctcagttagtagggatattgcatattatatgcaggg |
978156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 55 - 94
Target Start/End: Complemental strand, 3795835 - 3795796
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3795835 |
ttagctcagttggtagggatattgcatattatatgcaggg |
3795796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 17454819 - 17454768
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
17454819 |
tatccccgtgagcttatctcagttggtagagatattgcatattatatgcagg |
17454768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 19892349 - 19892298
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
19892349 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgtaggg |
19892298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 54 - 93
Target Start/End: Complemental strand, 28148795 - 28148756
Alignment:
| Q |
54 |
cttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28148795 |
cttagctcagttggtagggatattgcatattatatgcagg |
28148756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 29284263 - 29284314
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29284263 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgaaggg |
29284314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 32813723 - 32813672
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
32813723 |
atccccgtgagcttagttcagttggtacggatattgcatattatatgcaggg |
32813672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 3640517 - 3640559
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3640517 |
gtgagcttagctcagttggtagggatattgcatagtatatgca |
3640559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 7414332 - 7414374
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7414332 |
gtgagcttggctcagttggtagggatattgcatattatatgca |
7414374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 56 - 94
Target Start/End: Complemental strand, 10501199 - 10501161
Alignment:
| Q |
56 |
tagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10501199 |
tagctcagttggtagggatattgcatattatatgcaggg |
10501161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 14856029 - 14856103
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
14856029 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcctcttt |
14856103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 492905 - 492950
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
492905 |
gtgagcttagctcagttggcaaggatattgcatattatatgcaggg |
492950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 6419157 - 6419104
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| ||||| ||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6419157 |
atatccccgtgagtttaactcagttggtagagatattgcatattatatgcaggg |
6419104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 7418281 - 7418326
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7418281 |
gtgagcttaactcatttggtagggatattgcatattatatgcaggg |
7418326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 10628617 - 10628662
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10628617 |
gtgagtttagctcggttggtagggatattgcatattatatgcaggg |
10628662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 22997339 - 22997384
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
22997339 |
gtgagcttagctcagttggtagggatattgaatattatatgtaggg |
22997384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 23791062 - 23791017
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
23791062 |
gtgagcttagctcagttggtagggatattgaatattatatgtaggg |
23791017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 2816894 - 2816938
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
2816894 |
tgagcttagctcaattggtagggatattgcatgttatatgcaggg |
2816938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 55 - 95
Target Start/End: Complemental strand, 4089988 - 4089948
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4089988 |
ttagctcagtcggtagggatattgcatattatatgcaggga |
4089948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 7153792 - 7153836
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7153792 |
tgagcttaactcagttggtagggatattgcatgttatatgcaggg |
7153836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 12284124 - 12284168
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
12284124 |
gtgagcttaactcagttggtagggatattgaatattatatgcagg |
12284168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 55 - 91
Target Start/End: Complemental strand, 16966455 - 16966419
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16966455 |
ttagctcagttggtagggatattgcatattatatgca |
16966419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 31104878 - 31104930
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||| ||||||| |||||||||| |||||||||||||||| |
|
|
| T |
31104878 |
tatccccgtgagcttagttcagttgatagggatattacatattatatgcaggg |
31104930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 32050032 - 32049988
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32050032 |
gtgagcttaactcagctggtagggatattgcatattatatgcagg |
32049988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 88
Target Start/End: Original strand, 3196622 - 3196661
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3196622 |
gtgagcttagctcagttggtagggatattacatattatat |
3196661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 7581041 - 7581092
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
7581041 |
atccccgtgagcttagcttagctggtagggatattgcattttatatgcaggg |
7581092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 8297624 - 8297675
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| |||||| |||||||||||| |
|
|
| T |
8297624 |
atccccgtgagcttagctcaattggtagggatgttgcatgttatatgcaggg |
8297675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 28222866 - 28222909
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28222866 |
gtgaacttaactcagttggtagggatattgcatattatatgcag |
28222909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 29733625 - 29733676
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||| |||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
29733625 |
atccccgtgaacttagctcagttggtacggatattacatattatatgcaggg |
29733676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 50 - 93
Target Start/End: Complemental strand, 30700257 - 30700214
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30700257 |
tgagcttaactcagttggtacggatattgcatattatatgcagg |
30700214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 30704957 - 30705008
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||| ||||||| |||| |
|
|
| T |
30704957 |
atccccgtgagcttagttcagttggtagggatattgcatgttatatgtaggg |
30705008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 96
Target Start/End: Original strand, 30938391 - 30938438
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
30938391 |
gtgagcttaactcagttggtagggacattgcataatatatgcagggac |
30938438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 33697186 - 33697135
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
33697186 |
atccccgtgagcttaactcagttgatagggatattgcattttatatgcaggg |
33697135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 5052146 - 5052096
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
5052146 |
atccccgtgagcttagctcaattggtagggatatcgcattttatatgcagg |
5052096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 14847171 - 14847245
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| ||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
14847171 |
tcattgtatttctctataaatagaactcatatgtaacctaattatacatcacaagagaataatataatcttcttt |
14847245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 20568357 - 20568307
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||||||| ||| |||||||| ||||||||||| |
|
|
| T |
20568357 |
tccccgtgagcttagctcagttggtaaggacattgcataatatatgcaggg |
20568307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 20584070 - 20584120
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||| |||| |
|
|
| T |
20584070 |
atccctgtgagcttaactcagttgatagcgatattgcatattatatacagg |
20584120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 43 - 89
Target Start/End: Original strand, 21248529 - 21248575
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21248529 |
atccccgtaagcttagctcagttggtagggatattgcattttatatg |
21248575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 26680662 - 26680736
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| ||||||||||||| ||||| ||||| |
|
|
| T |
26680662 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataacataatcctcttt |
26680736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 60 - 94
Target Start/End: Complemental strand, 32412369 - 32412335
Alignment:
| Q |
60 |
tcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32412369 |
tcagttggtagggatattgcatattatatgcaggg |
32412335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 1435812 - 1435857
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||| |||||||||||| |||||||||||||||| |
|
|
| T |
1435812 |
gtgagcttaactcagtaggtagggatattacatattatatgcaggg |
1435857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 3299034 - 3298989
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||| |||||||||| |
|
|
| T |
3299034 |
gtgagcttagatcaattggtagggatattgcatataatatgcaggg |
3298989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 96 - 133
Target Start/End: Original strand, 7153853 - 7153890
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagct |
133 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7153853 |
cggacactccacttcttcacaatttaattgtgtgagct |
7153890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 7328714 - 7328669
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
7328714 |
gtgagcttaactcagttggtagggatattgcattttatatccaggg |
7328669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 91
Target Start/End: Complemental strand, 13116698 - 13116649
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
13116698 |
tatccctgcgagcttagctcagttggtaaggatatcacatattatatgca |
13116649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 55 - 92
Target Start/End: Complemental strand, 13158770 - 13158733
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13158770 |
ttagctaagttggtagggatattgcatattatatgcag |
13158733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 55 - 92
Target Start/End: Complemental strand, 13163626 - 13163589
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13163626 |
ttagctaagttggtagggatattgcatattatatgcag |
13163589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 46 - 91
Target Start/End: Original strand, 15285543 - 15285588
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
15285543 |
cctgtgagtttaactcagttggtagggatattacatattatatgca |
15285588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 23610386 - 23610341
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | ||||||||| |
|
|
| T |
23610386 |
gtgagcttagctcagttggtagggacattgcataatttatgcaggg |
23610341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 216271 - 216311
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
216271 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
216311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 62 - 94
Target Start/End: Complemental strand, 894686 - 894654
Alignment:
| Q |
62 |
agttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
894686 |
agttggtagggatattgcatattatatgcaggg |
894654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 2426129 - 2426169
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
2426129 |
cggacactccacttctccacaatttaattgtgtgagctcta |
2426169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 53 - 89
Target Start/End: Complemental strand, 2500577 - 2500541
Alignment:
| Q |
53 |
gcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2500577 |
gcttagcttagttggtagggatattgcatattatatg |
2500541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 52 - 88
Target Start/End: Complemental strand, 2688643 - 2688607
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2688643 |
agcttagctcagttggtaaggatattgcatattatat |
2688607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 2816955 - 2816995
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
2816955 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
2816995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 3294829 - 3294869
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
3294829 |
cggacaccccacttcttcacaattaaattgtgtgagttcta |
3294869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 3640579 - 3640619
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
3640579 |
cggacactccacttctccacaatttaattgtgtgagctcta |
3640619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 62 - 94
Target Start/End: Original strand, 5944442 - 5944474
Alignment:
| Q |
62 |
agttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5944442 |
agttggtagggatattgcatattatatgcaggg |
5944474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 53 - 93
Target Start/End: Original strand, 7072085 - 7072125
Alignment:
| Q |
53 |
gcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7072085 |
gcttaactcagttggtagggatattacatattatatgcagg |
7072125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 8297692 - 8297732
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
8297692 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
8297732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 9435691 - 9435731
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
9435691 |
cggacactccacttctccacaatttaattgtgtgagctcta |
9435731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 11301432 - 11301472
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
11301432 |
cggacactccacttcttcacaattaaattgtgtgagctcta |
11301472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 13158714 - 13158674
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
13158714 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
13158674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 13163570 - 13163530
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
13163570 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
13163530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 89
Target Start/End: Original strand, 21203041 - 21203081
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21203041 |
gtgagtttagctcagttggtagggatattgcatatcatatg |
21203081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 24758735 - 24758787
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||| |||| ||||||||||||| |||| |||||||||||| |
|
|
| T |
24758735 |
tatccccgtgagcttaactcaattggtagggatatcgcattttatatgcaggg |
24758787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 89
Target Start/End: Original strand, 27218887 - 27218927
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27218887 |
gtgaccttagctcagttgatagggatattgcatattatatg |
27218927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 30705025 - 30705065
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
30705025 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
30705065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 32166434 - 32166474
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
32166434 |
cggacactccacttctccacaatttaattgtgtgagctcta |
32166474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 89
Target Start/End: Original strand, 32837345 - 32837385
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
32837345 |
gtgagcttagctcagttgctagggatattacatattatatg |
32837385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 33646900 - 33646940
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
33646900 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
33646940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 136
Target Start/End: Complemental strand, 30310 - 30271
Alignment:
| Q |
97 |
ggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
30310 |
ggacactccacttcttcacaatttaattgtgtgagttcta |
30271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 92
Target Start/End: Complemental strand, 1100306 - 1100263
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
1100306 |
gtgaacttagctcagttggtagggatatagcattttatatgcag |
1100263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 94
Target Start/End: Original strand, 5694923 - 5694962
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5694923 |
ttaggtcagttggtagggatattgtatattatatgcaggg |
5694962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 87
Target Start/End: Complemental strand, 7470793 - 7470758
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattata |
87 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7470793 |
agcttagctcagttggtagggataatgcatattata |
7470758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 93
Target Start/End: Original strand, 11301371 - 11301414
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
11301371 |
tgagcatagctcagttgataggaatattgcatattatatgcagg |
11301414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 136
Target Start/End: Original strand, 18071599 - 18071638
Alignment:
| Q |
97 |
ggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
18071599 |
ggacaccccacctcttcacaattaaattgtgtgagctcta |
18071638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 88
Target Start/End: Complemental strand, 19618795 - 19618756
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
19618795 |
gtgagtttagctcaattggtagggatattgcatattatat |
19618756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 136
Target Start/End: Original strand, 20729017 - 20729056
Alignment:
| Q |
97 |
ggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
20729017 |
ggacactccacttcctcacaatttaattgtgtgagctcta |
20729056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 31705896 - 31705947
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||| |||||| |||| |
|
|
| T |
31705896 |
atccccgtgagcttagctcagttggtatggatattgcattatatatgtaggg |
31705947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 91
Target Start/End: Original strand, 32283536 - 32283583
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| | |||||| |
|
|
| T |
32283536 |
tccctgtgagcttagctcaattggtagggacattgcataatttatgca |
32283583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 2426067 - 2426109
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||| |||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
2426067 |
gtgaacttagctcagttggtaggaatattacatattatatgca |
2426109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Complemental strand, 3795777 - 3795739
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
3795777 |
gacactccacttctccacaatttaattgtgtgagctcta |
3795739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 6658643 - 6658593
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||||||| |||| ||||||| |||||||| ||||||||||| |
|
|
| T |
6658643 |
tccccgtgagcttagcttagttagtagggaaattgcataatatatgcaggg |
6658593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 986 - 1056
Target Start/End: Complemental strand, 10345789 - 10345720
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcat |
1056 |
Q |
| |
|
||||| || |||| ||||||||||| |||||||||| |||||| ||| |||||||||||||| ||||||| |
|
|
| T |
10345789 |
tcattctatttctatataaatagagttcacatgtaacttaattg-acaacacaagagaataatataatcat |
10345720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 10780168 - 10780126
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
10780168 |
gtgagcttagctcagttggtagggacaatgcataatatatgca |
10780126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 94
Target Start/End: Complemental strand, 10913143 - 10913101
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||| |||| | ||||||||||||||||||||||| |
|
|
| T |
10913143 |
agcttagctcagctggtggagatattgcatattatatgcaggg |
10913101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 14579359 - 14579309
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||| |||||| | ||||||||||||||||| |||||||||||| |
|
|
| T |
14579359 |
atccccgtgagtttagcttatttggtagggatattgcaaattatatgcagg |
14579309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 26347471 - 26347509
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
26347471 |
gacactccacttctccacaatttaattgtgtgagctcta |
26347509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 34268280 - 34268330
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||| ||||||||||| |||||||| | ||||||||| |
|
|
| T |
34268280 |
tccccgtgagcttagctccgttggtagggacattgcataatttatgcaggg |
34268330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 136
Target Start/End: Original strand, 7545397 - 7545434
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
7545397 |
acaccccacttctccacaattaaattgtgtgagctcta |
7545434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 55 - 84
Target Start/End: Complemental strand, 31803657 - 31803628
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatatt |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31803657 |
ttagctcagttggtagggatattgcatatt |
31803628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 50 - 83
Target Start/End: Complemental strand, 31956236 - 31956203
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatat |
83 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
31956236 |
tgagcttagctcagttggtagggatatcgcatat |
31956203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 65; Significance: 5e-28; HSPs: 214)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 42 - 133
Target Start/End: Original strand, 41689878 - 41689972
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagggac---ggacaccccacttcttcacaatttaattgtgtgagct |
133 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
41689878 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccctggacaccccacttctccacaattaaattgtgtgagct |
41689972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 966 - 1060
Target Start/End: Original strand, 2232087 - 2232180
Alignment:
| Q |
966 |
tacttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||| || ||||||||| |||||||||||||||| |||||| ||||| ||||| |
|
|
| T |
2232087 |
tacttaactcttaagtcatatcattatacttctctataaatatagatcatatgtaacat-attgtacaccacaagataataatataatcctcttt |
2232180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 12299 - 12247
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12299 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
12247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 94586 - 94534
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
94586 |
atatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
94534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 8265264 - 8265316
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8265264 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
8265316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 969 - 1021
Target Start/End: Complemental strand, 13242939 - 13242887
Alignment:
| Q |
969 |
ttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaa |
1021 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13242939 |
ttaactcttaagtcatatcattgtacttctctataaatagagatcacatgtaa |
13242887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 27077171 - 27077119
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27077171 |
tatctctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
27077119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 1937306 - 1937357
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1937306 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
1937357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 5328640 - 5328589
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5328640 |
atccctgtaagcttagctcagttggtagggatattgcatattatatgcaggg |
5328589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 16449122 - 16449173
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16449122 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
16449173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 17698518 - 17698569
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17698518 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
17698569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 26022244 - 26022295
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26022244 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
26022295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 32719680 - 32719629
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32719680 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
32719629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 35939484 - 35939535
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35939484 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
35939535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 42006774 - 42006825
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42006774 |
tatctctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
42006825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 933 - 1056
Target Start/End: Original strand, 7545991 - 7546114
Alignment:
| Q |
933 |
ttcttttaagtcacacctatttgtatttattct---tacttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaacataattg |
1029 |
Q |
| |
|
||||| ||| |||||| |||||||| ||||| | ||||||||||||||||||| | |||||||||||||||||||| | |||||||||||| |||| |
|
|
| T |
7545991 |
ttcttctaaatcacacatatttgtacttattttaagtacttaactcttaagtcatgt---tgtacttctctataaatagatatcacatgtaacattattg |
7546087 |
T |
 |
| Q |
1030 |
tacaccacaagagaataatgtaatcat |
1056 |
Q |
| |
|
|| | |||||||||| ||| ||||||| |
|
|
| T |
7546088 |
tataacacaagagaacaatataatcat |
7546114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 10736947 - 10736897
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10736947 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
10736897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 11875883 - 11875933
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11875883 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
11875933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 11890890 - 11890940
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11890890 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
11890940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 40 - 90
Target Start/End: Complemental strand, 17027956 - 17027906
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17027956 |
gatatccccgtgagcttagctcagttggtagggatattgcatattatatgc |
17027906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 40 - 90
Target Start/End: Complemental strand, 17558392 - 17558342
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17558392 |
gatatccccgtgagcttagctcagttggtagggatattgcatattatatgc |
17558342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 23178963 - 23178913
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23178963 |
tccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
23178913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 23435306 - 23435256
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23435306 |
atccctgtgagcttagctcagttgatagggatattgcatattatatgcagg |
23435256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 29716857 - 29716907
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29716857 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
29716907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 34413059 - 34413109
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34413059 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
34413109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 38620414 - 38620364
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38620414 |
atccctgtgagcttagctcagttggtagggatattgtatattatatgcagg |
38620364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 42 - 92
Target Start/End: Original strand, 39362261 - 39362311
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39362261 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcag |
39362311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 23858200 - 23858245
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23858200 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
23858245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 2787148 - 2787104
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2787148 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
2787104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 8034486 - 8034434
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8034486 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatgcaggg |
8034434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 8862196 - 8862148
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8862196 |
cctgtgagcttagctaagttggtagggatattgcatattatatgcaggg |
8862148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 30972891 - 30972843
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30972891 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgc |
30972843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 34158724 - 34158680
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34158724 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
34158680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 43656032 - 43656084
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43656032 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgtaggg |
43656084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 2792776 - 2792827
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2792776 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgcaggg |
2792827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 6659285 - 6659336
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6659285 |
tatccccgtgagattagctcagttggtagggatattgcatattatatgcagg |
6659336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 6739687 - 6739738
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6739687 |
tatccccgtgagattagctcagttggtagggatattgcatattatatgcagg |
6739738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 20540179 - 20540128
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20540179 |
atccccgtgagcttagctcagttgttagggatattgcatattatatgcaggg |
20540128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 26567322 - 26567271
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26567322 |
tatccccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
26567271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 29514622 - 29514673
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29514622 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatgcagg |
29514673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 33617969 - 33618020
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33617969 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggg |
33618020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 34266008 - 34266059
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34266008 |
tatccccgcgagcttagctcagttggtagggatattgcatattatatgcagg |
34266059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 34894366 - 34894417
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34894366 |
atccccgtaagcttagctcagttggtagggatattgcatattatatgcaggg |
34894417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 133412 - 133462
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
133412 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
133462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 6280477 - 6280527
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6280477 |
atccccgtgagcttagctcagttggtagggatattgaatattatatgcagg |
6280527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 10030409 - 10030459
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10030409 |
atccctgtgagtttagctcagttggtagagatattgcatattatatgcagg |
10030459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 12756229 - 12756155
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
12756229 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcatcttt |
12756155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 14876675 - 14876625
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14876675 |
atccccgtgagcttagctcagttggtagggaaattgcatattatatgcagg |
14876625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 28909462 - 28909512
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28909462 |
atccccgtgagcttagctcagttggtagggatattgcatattacatgcagg |
28909512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 39 - 93
Target Start/End: Original strand, 34472290 - 34472344
Alignment:
| Q |
39 |
ggatatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| || ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34472290 |
ggatattcccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
34472344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 37717360 - 37717410
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37717360 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
37717410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 38219641 - 38219591
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38219641 |
atccccgtgagcatagctcagttggtagggatattgcatattatatgcagg |
38219591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 43284039 - 43283989
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43284039 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcagg |
43283989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 8698647 - 8698602
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8698647 |
gtgagcttagctcagttggtagggatattgcatattatatgtaggg |
8698602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 10083166 - 10083211
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10083166 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggg |
10083211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 10568080 - 10568133
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10568080 |
atatccccgtgagtttagctcagttggtagggatattgcatattaaatgcaggg |
10568133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 10573104 - 10573149
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10573104 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggg |
10573149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 24296935 - 24296890
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24296935 |
gtgagcttagctcagttagtagggatattgcatattatatgcaggg |
24296890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 40362051 - 40362096
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40362051 |
gtgagcttagctcagttagtagggatattgcatattatatgcaggg |
40362096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 41458298 - 41458343
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41458298 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggg |
41458343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 257535 - 257587
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
257535 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggg |
257587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 658385 - 658333
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
658385 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggg |
658333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 844121 - 844069
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
844121 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggg |
844069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 1632515 - 1632463
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
1632515 |
atatcactgtgagcttagctcagttggtaggaatattacatattatatgcagg |
1632463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 41 - 93
Target Start/End: Original strand, 7194258 - 7194309
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7194258 |
atatccct-tgagcttagttcagttggtagggatattgcatattatatgcagg |
7194309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 7388451 - 7388503
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7388451 |
tatccccgtgaacttaactcagttggtagggatattgcatattatatgcaggg |
7388503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 10200748 - 10200704
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10200748 |
gtgagcttagctcagttggtagagatattgcatattatatgcagg |
10200704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 13406603 - 13406647
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13406603 |
gtgagcttaactcagttggtagggatattgcatattatatgcagg |
13406647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 16432195 - 16432151
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16432195 |
gtgaacttagctcagttggtagggatattgcatattatatgcagg |
16432151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 24458313 - 24458365
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
24458313 |
tatccccgtgagcttagctcagttggaagggatattgtatattatatgcaggg |
24458365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 31451024 - 31450980
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31451024 |
gtgagcttaactcagttggtagggatattgcatattatatgcagg |
31450980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 38344052 - 38344096
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38344052 |
gtgagcttaactcagttggtagggatattgcatattatatgcagg |
38344096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 43186856 - 43186900
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186856 |
gtgagtttagctcagttggtagggatattgcatattatatgcagg |
43186900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 43 - 87
Target Start/End: Complemental strand, 44340418 - 44340374
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattata |
87 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44340418 |
atccccgtgagcttagctcagttggtagggatattgcatattata |
44340374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 51 - 94
Target Start/End: Complemental strand, 7764004 - 7763961
Alignment:
| Q |
51 |
gagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7764004 |
gagcttagctcagttggtagagatattgcatattatatgcaggg |
7763961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 52 - 91
Target Start/End: Complemental strand, 10587341 - 10587302
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10587341 |
agcttagctcagttggtagggatattgcatattatatgca |
10587302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 966 - 1053
Target Start/End: Complemental strand, 16845808 - 16845722
Alignment:
| Q |
966 |
tacttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaat |
1053 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| | |||||||| |||||||||||| ||||||||| | || ||||||||||| |||| |
|
|
| T |
16845808 |
tacttaactcataagtgatatcattgtactttttaataaatag-gaccacatgtaatataattgtatatcataagagaataatataat |
16845722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 17072636 - 17072585
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
17072636 |
atccccgtgagcttagcacagttggtaggtatattgcatattatatgcaggg |
17072585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 17575635 - 17575686
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
17575635 |
atccccgtgagcttagcacagttggtaggtatattgcatattatatgcaggg |
17575686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 50 - 93
Target Start/End: Complemental strand, 22274677 - 22274634
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22274677 |
tgagtttagctcagttggtagggatattgcatattatatgcagg |
22274634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 49 - 92
Target Start/End: Complemental strand, 26192783 - 26192740
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26192783 |
gtgagcttagttcagttggtagggatattgcatattatatgcag |
26192740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 36540284 - 36540335
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36540284 |
atccccgtgagcttaactcagttggtagggatattgcattttatatgcaggg |
36540335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 38955267 - 38955216
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38955267 |
atccccgtgagcttaactcagttggtagggatattacatattatatgcaggg |
38955216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 48 - 94
Target Start/End: Complemental strand, 197132 - 197086
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
197132 |
tgtgagcttagctcagttggtagggatattgcatataatatgtaggg |
197086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 48 - 94
Target Start/End: Complemental strand, 311969 - 311923
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
311969 |
tgtgagcttagctcagttggtagggatattgcatataatatgtaggg |
311923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 3190022 - 3189972
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3190022 |
atccccgtgtgcatagctcagttggtagggatattgcatattatatgcagg |
3189972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 7797127 - 7797177
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7797127 |
atccccgtaagcttagctcagttggtagggatattgaatattatatgcagg |
7797177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 7816400 - 7816450
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7816400 |
atccccgtaagcttagctcagttggtagggatattgaatattatatgcagg |
7816450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 8969092 - 8969142
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||| ||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
8969092 |
atccatgtgagcttagctaagttggtaggaatattgcatattatatgcagg |
8969142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 24052101 - 24052027
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
24052101 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcttcttt |
24052027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 42 - 92
Target Start/End: Complemental strand, 37535573 - 37535523
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||| ||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37535573 |
tatctctgtgagtttagctcaattggtagggatattgcatattatatgcag |
37535523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 38402249 - 38402299
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38402249 |
tccccgtgagcttaactcagttggtagggatattgcatattatttgcaggg |
38402299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 42 - 84
Target Start/End: Complemental strand, 38745353 - 38745311
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatatt |
84 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38745353 |
tatccccgtgagcttagctcagttggtagggatattgcatatt |
38745311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 89
Target Start/End: Original strand, 42880945 - 42880991
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42880945 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
42880991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 49 - 95
Target Start/End: Complemental strand, 43980380 - 43980334
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43980380 |
gtgagcttagttcagttgttagggatattgcatattatatgcaggga |
43980334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 50 - 91
Target Start/End: Complemental strand, 4654176 - 4654135
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4654176 |
tgagcttagctcagttgctagggatattgcatattatatgca |
4654135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 5326243 - 5326194
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
5326243 |
atccccgtgagcttagctcagttggtagagatattgcattttatatgcag |
5326194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 5570897 - 5570942
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
5570897 |
gtgagcttagctcagttggttgggatattgcatgttatatgcaggg |
5570942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 53 - 94
Target Start/End: Complemental strand, 7109353 - 7109312
Alignment:
| Q |
53 |
gcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7109353 |
gcttagctcagttggtagagatattgcatattatatgcaggg |
7109312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 22437857 - 22437812
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
22437857 |
gtgagcttagctcagttggtagggatattgcataatttatgcaggg |
22437812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 90
Target Start/End: Complemental strand, 28420491 - 28420450
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28420491 |
gtgagcttagctcagttggtaggaatattgcatattatatgc |
28420450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 51 - 92
Target Start/End: Complemental strand, 37524272 - 37524231
Alignment:
| Q |
51 |
gagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37524272 |
gagcttagctcagttggtagagatattgcatattatatgcag |
37524231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 43856449 - 43856404
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43856449 |
gtgagcttaactcagttggtagggatattgcattttatatgcaggg |
43856404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 48 - 88
Target Start/End: Complemental strand, 3949149 - 3949109
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3949149 |
tgtgagcttaactcagttggtagggatattgcatattatat |
3949109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 4615743 - 4615699
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4615743 |
gtgagtttagttcagttggtagggatattgcatattatatgcagg |
4615699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 7765646 - 7765690
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
7765646 |
gtgagcttagctcagttggtatggatattacatattatatgcagg |
7765690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 8953936 - 8953892
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
8953936 |
gtgagcttaacacagttggtagggatattgcatattatatgcagg |
8953892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 23178896 - 23178856
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23178896 |
cggacactccacttcttcacaatttaattgtgtgagctcta |
23178856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 43 - 91
Target Start/End: Original strand, 28628662 - 28628710
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
28628662 |
atccccgtgagcttagctcagttggtacggatattacatattatatgca |
28628710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 29260622 - 29260666
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29260622 |
gtgagcttaactcagctggtagggatattgcatattatatgcagg |
29260666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 29729114 - 29729166
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29729114 |
tatccccgtgagtttagttcagttggtagggatattgcatattatatacaggg |
29729166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 33604246 - 33604195
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
33604246 |
tatccccgtgagcttagctcagttggtagggatattg-atattacatgcaggg |
33604195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 43053952 - 43053908
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43053952 |
gtgagcttaactcagttggtagggatatttcatattatatgcagg |
43053908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 2168521 - 2168470
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||| |||||| |||| |
|
|
| T |
2168521 |
tatccccgtgagcttagctcagttggtagggatattacattttatatacagg |
2168470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 97 - 136
Target Start/End: Complemental strand, 7813558 - 7813519
Alignment:
| Q |
97 |
ggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7813558 |
ggacactccacttcttcacaatttaattgtgtgagctcta |
7813519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 9187296 - 9187249
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
9187296 |
atccccgtgagcttagctcagttggtagggatattacattttatatgc |
9187249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 96
Target Start/End: Complemental strand, 12273744 - 12273697
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||| ||||||| |
|
|
| T |
12273744 |
gtgagcttagctcagttagtaggaatattgcatattatatacagggac |
12273697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 48 - 91
Target Start/End: Original strand, 18942917 - 18942960
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
18942917 |
tgtgagcttagctcagttggtagggataatgcataatatatgca |
18942960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 48 - 95
Target Start/End: Complemental strand, 20164276 - 20164229
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||||||||| |||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
20164276 |
tgtgagcttaactcagttggtagagatattacatattatatgcaggga |
20164229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 26280857 - 26280810
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
26280857 |
atccccgtgagcttaactcagttggtagggatattgcattttatatgc |
26280810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 26734069 - 26734120
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| || ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26734069 |
atccccgtaagcttagctcagttggtagatatattgcatattatatgcaggg |
26734120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 96
Target Start/End: Original strand, 26796961 - 26797008
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
26796961 |
gtgagtttagctcagttggtagggacattgcatattttatgcagggac |
26797008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 88
Target Start/End: Original strand, 28460204 - 28460243
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28460204 |
gtgagcttaactcagttggtagggatattgcatattatat |
28460243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 90
Target Start/End: Original strand, 37092088 - 37092135
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37092088 |
atccccgtgagtttagctcagttggtagggatattgtatattatatgc |
37092135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 39587544 - 39587595
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||| |||||| ||||| |
|
|
| T |
39587544 |
atccccgtgagcttagctcagttggtagagatattgcattttatattcaggg |
39587595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 41616439 - 41616388
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||| || |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41616439 |
atccccgtgagcataactcagttggtagggatattgtatattatatgcaggg |
41616388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 59 - 94
Target Start/End: Original strand, 44444557 - 44444592
Alignment:
| Q |
59 |
ctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
44444557 |
ctcagttggtagggatattgcatattatatgcaggg |
44444592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 481009 - 481059
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||| | ||||||||| |
|
|
| T |
481009 |
tccccgtgagcttagctcagttggtagggacattgcataatttatgcaggg |
481059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 43 - 89
Target Start/End: Original strand, 2590146 - 2590192
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| |||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
2590146 |
atccccgtgagcttagctcaattagtagggatattgcatattatatg |
2590192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 52 - 94
Target Start/End: Original strand, 5683760 - 5683802
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
5683760 |
agcttagctcaattggtaggaatattgcatattatatgcaggg |
5683802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 55 - 93
Target Start/End: Complemental strand, 13647518 - 13647480
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13647518 |
ttagctcagttggtagagatattgcatattatatgcagg |
13647480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 55 - 93
Target Start/End: Complemental strand, 13747943 - 13747905
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13747943 |
ttagctcagttggtagagatattgcatattatatgcagg |
13747905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 52 - 94
Target Start/End: Complemental strand, 19161959 - 19161918
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19161959 |
agcttagctcagttggtagg-atattgcatattatatgcaggg |
19161918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 22487878 - 22487920
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22487878 |
gtgagtttagctcagttggtagggatattgcattttatatgca |
22487920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 37090686 - 37090636
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||| ||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
37090686 |
atccccgtgagtttaactcagttggtagggatattgtatattatatgcagg |
37090636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 52 - 94
Target Start/End: Original strand, 37838583 - 37838625
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37838583 |
agcttagctcaaatggtagggatattgcatattatatgcaggg |
37838625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 52 - 94
Target Start/End: Original strand, 40740531 - 40740573
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40740531 |
agcttaactcagttgatagggatattgcatattatatgcaggg |
40740573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 48 - 94
Target Start/End: Complemental strand, 41865150 - 41865104
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
41865150 |
tgtgagcttagctcagttggtggagatattacatattatatgcaggg |
41865104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 92
Target Start/End: Complemental strand, 1286617 - 1286576
Alignment:
| Q |
51 |
gagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
1286617 |
gagcttatctcaattggtagggatattgcatattatatgcag |
1286576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 48 - 93
Target Start/End: Original strand, 5332918 - 5332963
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
5332918 |
tgtgagcttagctcagttggtagagatattatatattatatgcagg |
5332963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 9370169 - 9370216
Alignment:
| Q |
50 |
tgagcttagctcagttg---gtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9370169 |
tgagcttagctcagttgttggtagggatattgcatattatatgcaggg |
9370216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 91
Target Start/End: Original strand, 19163859 - 19163908
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||| ||||| |||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
19163859 |
tatccttgtgaacttaactcagttggtagggatattgcatataatatgca |
19163908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 90
Target Start/End: Original strand, 32258010 - 32258051
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32258010 |
gtgagattagctcagttggtagggatattgcatattctatgc |
32258051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 37290925 - 37290970
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| || ||||| ||||||||||||||||||||||||||| |
|
|
| T |
37290925 |
gtgagcttaacttagttgatagggatattgcatattatatgcaggg |
37290970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 40094888 - 40094933
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| |||||||||||| |
|
|
| T |
40094888 |
gtgagcttagctcagttgataaggatattgcattttatatgcaggg |
40094933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 44260262 - 44260213
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||||| | ||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
44260262 |
atccctgtaaacttagctcagttgatagagatattgcatattatatgcag |
44260213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 44673715 - 44673670
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
44673715 |
gtgagcttagctcagttggtagggatatcacattttatatgcaggg |
44673670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 2294173 - 2294121
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||| |||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
2294173 |
tatccccgtgagtttagctcaattgatagggatattacatattatatgcaggg |
2294121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 2626070 - 2626030
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
2626070 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
2626030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 3227072 - 3227021
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||| |||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
3227072 |
tatccccgtgagattagttcagttggtagg-atattgcatattatatgcaggg |
3227021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 61 - 93
Target Start/End: Original strand, 5038573 - 5038605
Alignment:
| Q |
61 |
cagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5038573 |
cagttggtagggatattgcatattatatgcagg |
5038605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 104 - 136
Target Start/End: Complemental strand, 6511513 - 6511481
Alignment:
| Q |
104 |
ccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6511513 |
ccacttcttcacaatttaattgtgtgagctcta |
6511481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 7763944 - 7763904
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
7763944 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
7763904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 8265333 - 8265373
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
8265333 |
cggacactccacttctccacaatttaattgtgtgagctcta |
8265373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 10568150 - 10568190
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
10568150 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
10568190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 10594283 - 10594239
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||| | |||||||||||||||||||| ||||||||||| |
|
|
| T |
10594283 |
gtgagcttagtttagttggtagggatattgcattttatatgcagg |
10594239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 11127906 - 11127950
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
11127906 |
gtgaacttagctcagttggtaggaatattgcatattatatacagg |
11127950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 89
Target Start/End: Complemental strand, 11297060 - 11297020
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
11297060 |
gtgagcttagttcagttggtagggatattgcattttatatg |
11297020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 11483123 - 11483167
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
11483123 |
gtgagcgtagctcagttagtaggaatattgcatattatatgcagg |
11483167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 13647462 - 13647422
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
13647462 |
cggacactccacttctccacaatttaattgtgtgagctcta |
13647422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 13747887 - 13747847
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
13747887 |
cggacactccacttctccacaatttaattgtgtgagctcta |
13747847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 14245142 - 14245194
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||| |||| | |||||||||||||||||||||||||||| |||| |
|
|
| T |
14245142 |
tatccccgtgagtttaggtaagttggtagggatattgcatattatatgtaggg |
14245194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 17027886 - 17027846
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
17027886 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
17027846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 17558322 - 17558282
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
17558322 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
17558282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 18452352 - 18452308
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||| |||| |
|
|
| T |
18452352 |
gtgagcttagctcagttgttaggaatattgcatattatatacagg |
18452308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 18926209 - 18926157
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||| ||||||||| ||||||||||||| |||| |||||||||||| |
|
|
| T |
18926209 |
tatccccgtgaccttagctcaattggtagggatatcgcattttatatgcaggg |
18926157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 20872528 - 20872480
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| | ||||||||| |
|
|
| T |
20872528 |
cctgtgagcttagctcagttgatagggacattgcataatttatgcaggg |
20872480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 40 - 96
Target Start/End: Original strand, 23261295 - 23261351
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||| |||| | |||||||||||| |
|
|
| T |
23261295 |
gatatcctcgtgagcttagctgagttggtagggatatcgcatttcatatgcagggac |
23261351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 89
Target Start/End: Original strand, 33838327 - 33838367
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
33838327 |
gtgagtttagctcagttggtagggatattgcaaattatatg |
33838367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 37290987 - 37291027
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
37290987 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
37291027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 55 - 95
Target Start/End: Complemental strand, 38337088 - 38337048
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38337088 |
ttagttcagttggtagggatattgcatattatatgtaggga |
38337048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 986 - 1046
Target Start/End: Original strand, 41043571 - 41043631
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaata |
1046 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||| |
|
|
| T |
41043571 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaata |
41043631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 54 - 94
Target Start/End: Complemental strand, 42877399 - 42877359
Alignment:
| Q |
54 |
cttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
42877399 |
cttagctcagttggtagagatattgtatattatatgcaggg |
42877359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 93
Target Start/End: Original strand, 1503914 - 1503956
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
1503914 |
tgagcttagctcagttggcagggatattg-atattatatgcagg |
1503956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 136
Target Start/End: Complemental strand, 4654113 - 4654074
Alignment:
| Q |
97 |
ggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
4654113 |
ggacactccacttctccacaatttaattgtgtgagctcta |
4654074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 7453349 - 7453400
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||| ||||||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
7453349 |
atccccgtgagtttagctcagctggtagggatattgcattttatatgtaggg |
7453400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 92
Target Start/End: Complemental strand, 8402403 - 8402360
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||| ||||||||| |
|
|
| T |
8402403 |
gtgagcttagctcaattggtagggacattgcataatatatgcag |
8402360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 19957422 - 19957371
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggta-gggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||| |||||| |||||| |||||||||||||||||| |
|
|
| T |
19957422 |
tccctgtgaacttagctcacttggtaagggataatgcatattatatgcaggg |
19957371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 94
Target Start/End: Complemental strand, 24480886 - 24480843
Alignment:
| Q |
51 |
gagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
24480886 |
gagcttatctcagttggtagagatattgtatattatatgcaggg |
24480843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 91
Target Start/End: Original strand, 30623288 - 30623335
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | |||||| |||||||| |
|
|
| T |
30623288 |
tccctgtgagcttagctcagttggtaaggacaatgcataatatatgca |
30623335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 136
Target Start/End: Complemental strand, 31153023 - 31152984
Alignment:
| Q |
97 |
ggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
31153023 |
ggacaccccacttctccacaattaaattgtgtgagctcta |
31152984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 136
Target Start/End: Original strand, 32258073 - 32258112
Alignment:
| Q |
97 |
ggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
32258073 |
ggacaccccacttctccacaattaaattgtgtgagctcta |
32258112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 96
Target Start/End: Original strand, 39974844 - 39974891
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| | ||| ||||||| |
|
|
| T |
39974844 |
gtgagcttagctcagttggtaggaatattgcataatttatacagggac |
39974891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 43085296 - 43085245
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
43085296 |
atccccgtgagcttagctcagttgggagggatatcacattttatatgcaggg |
43085245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 43403289 - 43403340
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
43403289 |
atccctatgagcttaattcagttggtagagatattgcatattatatgtaggg |
43403340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 96 - 134
Target Start/End: Original strand, 2792844 - 2792882
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctc |
134 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
2792844 |
cggacactccacttctccacaatttaattgtgtgagctc |
2792882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 48 - 94
Target Start/End: Complemental strand, 10557565 - 10557519
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||| |
|
|
| T |
10557565 |
tgtgagcttagctcaattggcagcgatattgcataatatatgcaggg |
10557519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 11708986 - 11709028
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
11708986 |
gtgagcttagctcagttggtagggacaatgcataatatatgca |
11709028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 48 - 94
Target Start/End: Original strand, 12736191 - 12736237
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||| ||| || |||||||||||||||| |
|
|
| T |
12736191 |
tgtgagcttagctcagttggtaaggacgttacatattatatgcaggg |
12736237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 13059249 - 13059199
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||||||||||| | |||||| | ||||||||| |
|
|
| T |
13059249 |
tccccgtgagcttagctcagttggtagggacaatgcataatttatgcaggg |
13059199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 89
Target Start/End: Complemental strand, 13773465 - 13773419
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| |||| | ||||||||||||||| |||||||||||||||||| |
|
|
| T |
13773465 |
atcccagtgaacgtagctcagttggtagagatattgcatattatatg |
13773419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #192
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 16449192 - 16449230
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
16449192 |
gacactccacttctccacaatttaattgtgtgagctcta |
16449230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #193
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 21133074 - 21133112
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
21133074 |
gacaccccacttctccacaattaaattgtgtgagctcta |
21133112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #194
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 23816790 - 23816832
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
23816790 |
gtgagcttagctcagttggtaaggataatgcataatatatgca |
23816832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #195
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 96 - 134
Target Start/End: Complemental strand, 27077102 - 27077064
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctc |
134 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
27077102 |
cggacaccccacttctccacaattaaattgtgtgagctc |
27077064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #196
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 29729186 - 29729224
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
29729186 |
gacactccacttctccacaatttaattgtgtgagctcta |
29729224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #197
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 29734078 - 29734028
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||| ||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
29734078 |
atccccgtgagtttaactcagttggtaaggatattgtatattatatgcagg |
29734028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #198
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 33451410 - 33451368
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
33451410 |
gtgagcttagctcagttggtatggataatgcataatatatgca |
33451368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #199
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 95
Target Start/End: Complemental strand, 33473422 - 33473376
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
33473422 |
gtgaacttagctcagttggtagggatatcacattttatatgcaggga |
33473376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #200
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 39821884 - 39821926
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
39821884 |
gtgagcttagctcagttggtagggacaatgcataatatatgca |
39821926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #201
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 87
Target Start/End: Original strand, 42457136 - 42457174
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattata |
87 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
42457136 |
gtgagtttatctcagttggtagggatattgcatattata |
42457174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #202
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 42877032 - 42877082
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||||||||| |||||||||| |||||||| | ||||||||| |
|
|
| T |
42877032 |
tccccgtgagcttagctcaattggtagggacattgcataatttatgcaggg |
42877082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #203
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 3912237 - 3912188
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||| ||||| ||| ||| ||||||||| |||||||||||||||||||| |
|
|
| T |
3912237 |
atccccgtgagtttaactcggttggtaggaatattgcatattatatgcag |
3912188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #204
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 104 - 133
Target Start/End: Complemental strand, 7776127 - 7776098
Alignment:
| Q |
104 |
ccacttcttcacaatttaattgtgtgagct |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7776127 |
ccacttcttcacaatttaattgtgtgagct |
7776098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #205
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 13591816 - 13591865
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||| ||||| ||| |||||||||||||||||| |||| |||||||||| |
|
|
| T |
13591816 |
atccccgtgagtttaactcagttggtagggatatcgcattttatatgcag |
13591865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #206
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 136
Target Start/End: Complemental strand, 17072565 - 17072528
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
17072565 |
acaccccacttctccacaattaaattgtgtgagctcta |
17072528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #207
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 136
Target Start/End: Original strand, 17575706 - 17575743
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
17575706 |
acaccccacttctccacaattaaattgtgtgagctcta |
17575743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #208
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 97 - 130
Target Start/End: Complemental strand, 23339900 - 23339867
Alignment:
| Q |
97 |
ggacaccccacttcttcacaatttaattgtgtga |
130 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
23339900 |
ggacaccccacttcttcacaattaaattgtgtga |
23339867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #209
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 23339963 - 23339918
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
23339963 |
gtgagcttaactcagttggtagagatattgtatattatatgtaggg |
23339918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #210
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 26395359 - 26395412
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||| |||| |||||||| || ||||||||||| |||||||||||| |
|
|
| T |
26395359 |
atatccccgtgaacttatctcagttgataaggatattgcattttatatgcaggg |
26395412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #211
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 57 - 94
Target Start/End: Original strand, 29499589 - 29499626
Alignment:
| Q |
57 |
agctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
29499589 |
agctcagttggtagggatattgcatgttatatgtaggg |
29499626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #212
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 44553595 - 44553640
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
44553595 |
gtgagtttagctcagttggtaggtataatgcatgttatatgcaggg |
44553640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #213
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 82
Target Start/End: Original strand, 45105699 - 45105732
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcata |
82 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
45105699 |
gtgagcttagctcagttggtagggataatgcata |
45105732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #214
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 45190626 - 45190581
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
45190626 |
gtgagcttaactcggttgatagagatattgcatattatatgcaggg |
45190581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 61; Significance: 1e-25; HSPs: 230)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 966 - 1054
Target Start/End: Original strand, 17033220 - 17033307
Alignment:
| Q |
966 |
tacttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatc |
1054 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| | ||||||||||| ||||| |
|
|
| T |
17033220 |
tacttaactcttaagtcatataattgtacttctctataaatagagaccacatgtaacat-attgtacattataagagaataatataatc |
17033307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 966 - 1026
Target Start/End: Complemental strand, 19307807 - 19307747
Alignment:
| Q |
966 |
tacttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaacataa |
1026 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
19307807 |
tacttaactcttaagtcatatcattgtatttctctataaatagagatcacatgtaacataa |
19307747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 15975148 - 15975199
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15975148 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
15975199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 42 - 96
Target Start/End: Complemental strand, 53347364 - 53347310
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53347364 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagggac |
53347310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 40 - 93
Target Start/End: Complemental strand, 44652058 - 44652005
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44652058 |
gatatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
44652005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 5636874 - 5636822
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5636874 |
atatccttgtgagcttagctcagttggtagggatattgcatattatatgcagg |
5636822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 882385 - 882436
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
882385 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
882436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 49 - 96
Target Start/End: Original strand, 8125642 - 8125689
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8125642 |
gtgagcttagctcagttggtagggatattgcatattatatgcagggac |
8125689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 19550502 - 19550553
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19550502 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
19550553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 19999864 - 19999915
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19999864 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
19999915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 22502004 - 22501953
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22502004 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
22501953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 28550392 - 28550341
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550392 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
28550341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 37800685 - 37800634
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37800685 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
37800634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 39966147 - 39966096
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39966147 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
39966096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 40933905 - 40933854
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40933905 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
40933854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 45701340 - 45701391
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45701340 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
45701391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 48251568 - 48251619
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48251568 |
tatccctgtgagcttagctcagttgatagggatattgcatattatatgcagg |
48251619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 50496888 - 50496837
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50496888 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
50496837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 52945892 - 52945943
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52945892 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
52945943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 7269952 - 7270002
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7269952 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
7270002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 31327574 - 31327524
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31327574 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
31327524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 31327791 - 31327741
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31327791 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
31327741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 42 - 92
Target Start/End: Original strand, 40192152 - 40192202
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40192152 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcag |
40192202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 40548300 - 40548350
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40548300 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
40548350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 52410314 - 52410264
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52410314 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
52410264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 42 - 91
Target Start/End: Original strand, 2522922 - 2522971
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2522922 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
2522971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 30779634 - 30779589
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30779634 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
30779589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 32256629 - 32256576
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32256629 |
atatccccgtgagcttagctcagttggtagggatattgcatgttatatgcaggg |
32256576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 47098735 - 47098780
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47098735 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
47098780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 4139003 - 4139047
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4139003 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
4139047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 6920030 - 6919986
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6920030 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
6919986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 43 - 91
Target Start/End: Original strand, 7920317 - 7920365
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7920317 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
7920365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 41 - 93
Target Start/End: Original strand, 18194333 - 18194385
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18194333 |
atatccccgtgagtttagctcagttggtagggatattgcatattatatgcagg |
18194385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 25939004 - 25938952
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25939004 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatgcaggg |
25938952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 28689747 - 28689695
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28689747 |
atatccccgtgaacttagctcagttggtagggatattgcatattatatgcagg |
28689695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 31586951 - 31586995
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31586951 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
31586995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 34898841 - 34898789
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34898841 |
tatccccgtgagcttagttcagttggtagggatattgcatattatatgcaggg |
34898789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 48739818 - 48739766
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48739818 |
tatccccgtgagcttagctcagttggtagggatattgcattttatatgcaggg |
48739766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 53432811 - 53432759
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
53432811 |
tatccctgtgagtttaactcagttggtagggatattgcatattatatgcaggg |
53432759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 3748675 - 3748624
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3748675 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgcaggg |
3748624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 10482927 - 10482876
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10482927 |
tatccccgtgaacttagctcagttggtagggatattgcatattatatgcagg |
10482876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 34102684 - 34102633
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34102684 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcaggg |
34102633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 50 - 93
Target Start/End: Complemental strand, 36625237 - 36625194
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36625237 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
36625194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 41936480 - 41936429
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41936480 |
atccccgtaagcttagctcagttggtagggatattgcatattatatgcaggg |
41936429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 46796002 - 46795951
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46796002 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgcaggg |
46795951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 40 - 91
Target Start/End: Original strand, 52984004 - 52984055
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52984004 |
gatattcctgtgagcttagctcagttggtagggatattgcatattgtatgca |
52984055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 53163591 - 53163642
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53163591 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgtaggg |
53163642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 48 - 99
Target Start/End: Complemental strand, 54021402 - 54021351
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcagggacgga |
99 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
54021402 |
tgtgagcttagctcagttggtatggatattgcatattatatgcagggccgga |
54021351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 9176653 - 9176611
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9176653 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
9176611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 10176976 - 10176926
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10176976 |
atccccgtgaggttagctcagttggtagggatattgcatattatatgcagg |
10176926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 13985352 - 13985426
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| ||||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
13985352 |
tcattgtatttctctataaatagagatcatatgtaacctaattatacatcacaagagaataatataatcctcttt |
13985426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 41 - 91
Target Start/End: Original strand, 17218483 - 17218533
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17218483 |
atatccccatgagcttagctcagttggtagggatattgcatattatatgca |
17218533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 19996525 - 19996475
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19996525 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
19996475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 52 - 94
Target Start/End: Original strand, 26942759 - 26942801
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26942759 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
26942801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 31529031 - 31528981
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31529031 |
atccccgtgagcttagctcagttggtagggatattgaatattatatgcagg |
31528981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 40802629 - 40802555
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
40802629 |
tcattgtatttctctataaatagagctcatatgtaacttaattatacatcacaagagaataatataatcatcttt |
40802555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 50536905 - 50536855
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50536905 |
atccccgtgagcttagctcagttggtagagatattgcatattatatgcagg |
50536855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 52974126 - 52974076
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52974126 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
52974076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 2368939 - 2368984
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2368939 |
gtgagcttagctcagttgttagggatattgcatattatatgcaggg |
2368984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 45 - 94
Target Start/End: Complemental strand, 4200656 - 4200607
Alignment:
| Q |
45 |
ccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4200656 |
ccctgtgaacttaactcagttggtagggatattgcatattatatgcaggg |
4200607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 52 - 93
Target Start/End: Complemental strand, 4640544 - 4640503
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4640544 |
agcttagctcagttggtagggatattgcatattatatgcagg |
4640503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 6488119 - 6488172
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6488119 |
atatccccatgagcttagctcaattggtagggatattgcatattatatgcaggg |
6488172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 11250658 - 11250613
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11250658 |
gtgaacttagctcagttggtagggatattgcatattatatgcaggg |
11250613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 17602743 - 17602698
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17602743 |
gtgagcttagctcagttggtagggatattgcatattatatgtaggg |
17602698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 42 - 91
Target Start/End: Complemental strand, 30555301 - 30555252
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30555301 |
tatccccgtgagcttagctcagttggtagggatattgcatattaaatgca |
30555252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 34847538 - 34847591
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34847538 |
atatccccgtgagcttaattcagttggtagggatattgcatattatatgcaggg |
34847591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 39719938 - 39719983
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39719938 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggg |
39719983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 49750473 - 49750428
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49750473 |
gtgagcttagctcagttgatagggatattgcatattatatgcaggg |
49750428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 20489819 - 20489863
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20489819 |
tgagcttagctcagttggtagggttattgcatattatatgcaggg |
20489863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 32828444 - 32828488
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32828444 |
gtgagcttagctcggttggtagggatattgcatattatatgcagg |
32828488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 50234127 - 50234171
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50234127 |
gtgagcttacctcagttggtagggatattgcatattatatgcagg |
50234171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 54769897 - 54769853
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54769897 |
gtgagcttagcttagttggtagggatattgcatattatatgcagg |
54769853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 8964850 - 8964799
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8964850 |
tatccccgtgagtttagctcagttggtagggatattgcatatcatatgcagg |
8964799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 17608392 - 17608341
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
17608392 |
atccccgtgagcttaacttagttggtagggatattgcatattatatgcaggg |
17608341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 37488533 - 37488482
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
37488533 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggg |
37488482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 45871014 - 45871065
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45871014 |
atccccgtgagtttagctcagttggtagggatattgtatattatatgcaggg |
45871065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 49408771 - 49408822
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
49408771 |
tatccccgtgagcttagctcagctggtagggatatcgcatattatatgcagg |
49408822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 48 - 91
Target Start/End: Original strand, 53577957 - 53578000
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53577957 |
tgtgagcttagctcagttggtagggatgttgcatattatatgca |
53578000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 53752773 - 53752722
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53752773 |
atccccgtgagcttaactcagttggtagggatatggcatattatatgcaggg |
53752722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 2174285 - 2174211
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
2174285 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcctcttt |
2174211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 3110576 - 3110502
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
3110576 |
tcattgtatttctctataaatagagctcatatgtaacttaattatacatcacaagagaataatataatcctcttt |
3110502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 3112193 - 3112119
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
3112193 |
tcattgtatttctctataaatagagctcatatgtaacttaattatacatcacaagagaataatataatcctcttt |
3112119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 89
Target Start/End: Original strand, 11820001 - 11820047
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11820001 |
atccccgtgagcttagctcagttggtagggatattgcatgttatatg |
11820047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 13990924 - 13990998
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
13990924 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaataatataatcctcttt |
13990998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 32144581 - 32144631
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
32144581 |
atccccgtgagcttagcttagttggtaggggtattgcatattatatgcagg |
32144631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 33225421 - 33225371
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
33225421 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
33225371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 40800705 - 40800631
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
40800705 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacataacaagagaataatataatcatcttt |
40800631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 42 - 92
Target Start/End: Original strand, 44364017 - 44364067
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||| ||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44364017 |
tatccccgtgagtttaactcagttggtagggatattgcatattatatgcag |
44364067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 48216403 - 48216329
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| || | |||||||||||||| ||||||||||| |
|
|
| T |
48216403 |
tcattgtatttctctataaatagagctcatatgtaacctaattatatatcacaagagaataatataatcatcttt |
48216329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 49 - 95
Target Start/End: Original strand, 48546176 - 48546222
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
48546176 |
gtgagcttagctcagttggtagtgatattgcatattatatgtaggga |
48546222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 49447135 - 49447185
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49447135 |
atccccgtgagtatagctcagttggtagggatattgcatattatatgcagg |
49447185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 48 - 94
Target Start/End: Original strand, 51772891 - 51772937
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
51772891 |
tgtgagcttaacttagttggtagggatattgcatattatatgcaggg |
51772937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 4541901 - 4541946
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4541901 |
gtgagcttagttcagttggtagggatattgtatattatatgcaggg |
4541946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 4860164 - 4860209
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
4860164 |
gtgagcttagctcagttggtacggatattgcattttatatgcaggg |
4860209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 11436507 - 11436552
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11436507 |
gtgaacttaactcagttggtagggatattgcatattatatgcaggg |
11436552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 27983850 - 27983903
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
27983850 |
atatccatgtgagcttagctcagttggtagaaatattgcattttatatgcaggg |
27983903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 29373516 - 29373471
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29373516 |
gtgagcttaactcagttggtaaggatattgcatattatatgcaggg |
29373471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 55 - 92
Target Start/End: Complemental strand, 42108243 - 42108206
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42108243 |
ttagctcagttggtagggatattgcatattatatgcag |
42108206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 3894547 - 3894591
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
3894547 |
gtgagcttagttcagttggtatggatattgcatattatatgcagg |
3894591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 16886582 - 16886630
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||| ||||| |
|
|
| T |
16886582 |
cctgtgagcttagctcagttggtagggacattgcatattgtatacaggg |
16886630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 43 - 91
Target Start/End: Complemental strand, 22472387 - 22472339
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||| ||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
22472387 |
atccccgtgagcttaactcagttggtagagatattgcatattatatgca |
22472339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 28193802 - 28193846
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28193802 |
tgagcttaactcagttggtagggatattgcattttatatgcaggg |
28193846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 50 - 94
Target Start/End: Complemental strand, 28396848 - 28396804
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28396848 |
tgagcttaactcagttggtagggatattgcatgttatatgcaggg |
28396804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 43 - 91
Target Start/End: Complemental strand, 33706800 - 33706752
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
33706800 |
atccccgtgagcttagctcaattggtagggatattacatattatatgca |
33706752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 37112814 - 37112858
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
37112814 |
tgagcttagctcagttggtaaggatattgcattttatatgcaggg |
37112858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 52309177 - 52309133
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
52309177 |
gtgagcttaactcagttggtagggatattgcatactatatgcagg |
52309133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 89
Target Start/End: Complemental strand, 52670220 - 52670180
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52670220 |
gtgagcttagttcagttggtagggatattgcatattatatg |
52670180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 48 - 91
Target Start/End: Original strand, 552173 - 552216
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
552173 |
tgtgagcttaactcagttggtagggatattgcataatatatgca |
552216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 4880172 - 4880215
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
4880172 |
gtgagcttagctcagttggtacggatattgcattttatatgcag |
4880215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 13638318 - 13638267
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||| ||||||||||| |||| |
|
|
| T |
13638318 |
atccccgtgagcttagttcagttggtagggatattacatattatatgtaggg |
13638267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 24430149 - 24430192
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
24430149 |
gtgagcttagctcagttggtagagatattgtatattatatgcag |
24430192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 50 - 89
Target Start/End: Complemental strand, 29559740 - 29559701
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29559740 |
tgagcttaactcagttggtagggatattgcatattatatg |
29559701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 47 - 94
Target Start/End: Complemental strand, 36834774 - 36834727
Alignment:
| Q |
47 |
ctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
36834774 |
ctgtgagcttagctcagctgatagggatattgtatattatatgcaggg |
36834727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 44106599 - 44106650
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| || ||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44106599 |
atccctttgggcttaactcagttgctagggatattgcatattatatgcaggg |
44106650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 45551882 - 45551831
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||| ||||||| |||| |
|
|
| T |
45551882 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgtaggg |
45551831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 46880000 - 46880043
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
46880000 |
gtgagcttagctcagttgatagggatattgcattttatatgcag |
46880043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 88
Target Start/End: Complemental strand, 52046452 - 52046413
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52046452 |
gtgagcttagctcagttggtagggatattgcattttatat |
52046413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 2390427 - 2390377
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| || ||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2390427 |
atccccgtaagcgtagctcagttgatagggatattgcatattatatgcagg |
2390377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 5326103 - 5326061
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
5326103 |
gtgagcttagctcagttggtagcgatattgcatattacatgca |
5326061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 8762153 - 8762103
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||| || |||||||||||||||| ||||||||||||||| |
|
|
| T |
8762153 |
atccccgtgagcttaacttagttggtagggatattacatattatatgcagg |
8762103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 13980723 - 13980649
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||| |||||||||| |||||||||||| ||||||||||| |
|
|
| T |
13980723 |
tcattgtatttctctataaatagagctcatatgtaatctaattgtacataccaagagaataatataatcatcttt |
13980649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 23338921 - 23338995
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| || | |||||||||||||| ||||| ||||| |
|
|
| T |
23338921 |
tcattgtatttctctataaatagagctcatatgtaacctaattatagatcacaagagaataatataatcctcttt |
23338995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 23344468 - 23344542
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| || | |||||||||||||| ||||| ||||| |
|
|
| T |
23344468 |
tcattgtatttctctataaatagagctcatatgtaacctaattatagatcacaagagaataatataatcctcttt |
23344542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 42 - 88
Target Start/End: Original strand, 31316630 - 31316676
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
31316630 |
tatccccgtgagcttagctcagttgatagggatattgtatattatat |
31316676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 48 - 94
Target Start/End: Original strand, 32776213 - 32776259
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| | ||||||||| |
|
|
| T |
32776213 |
tgtgagcttagctcagttggtagggacattgcataatttatgcaggg |
32776259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 34740290 - 34740332
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34740290 |
gtgagtttagcccagttggtagggatattgcatattatatgca |
34740332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 83
Target Start/End: Original strand, 34757532 - 34757566
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatat |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34757532 |
gtgagcttagctcagttggtagggatattgcatat |
34757566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 36763427 - 36763477
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||| |||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
36763427 |
tccccgtgagcttggctcagttggtagggacattgcataatatatgcaggg |
36763477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 54 - 96
Target Start/End: Complemental strand, 38819385 - 38819343
Alignment:
| Q |
54 |
cttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
38819385 |
cttagcttagttggtagggatatttcatattatatgcagggac |
38819343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 60 - 94
Target Start/End: Original strand, 42268798 - 42268832
Alignment:
| Q |
60 |
tcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42268798 |
tcagttggtagggatattgcatattatatgcaggg |
42268832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 52 - 94
Target Start/End: Original strand, 45198729 - 45198771
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
45198729 |
agcttagttcagttggtagggatattgcatattatatgtaggg |
45198771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 48515457 - 48515407
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| | ||||||||| |
|
|
| T |
48515457 |
tccctgtgagcttaactcagttggtagggatattccataatttatgcaggg |
48515407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 52575461 - 52575511
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
52575461 |
tccccgtgagcttagctcagttggtacgaatattgcattttatatgcaggg |
52575511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 986 - 1059
Target Start/End: Complemental strand, 2168718 - 2168645
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatctt |
1059 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||| | ||||| |||| |||||||||||||| ||||| |||| |
|
|
| T |
2168718 |
tcattgtatttctctataaatagagctcatatgtagcctaattatacatcacaagagaataatataatcctctt |
2168645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 8756527 - 8756572
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
8756527 |
gtgagcttaactcagttggtaggaatattgcattttatatgcaggg |
8756572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 99 - 136
Target Start/End: Original strand, 19879269 - 19879306
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19879269 |
acaccccacttcttcacaattaaattgtgtgagctcta |
19879306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 20887836 - 20887791
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
20887836 |
gtgagtttagctcagttggtagggatattgcataatttatgcaggg |
20887791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 25279126 - 25279081
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||| |||| |
|
|
| T |
25279126 |
gtgagcttagcttagttggtagggatattgtatattatatgtaggg |
25279081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 52 - 93
Target Start/End: Original strand, 25833829 - 25833870
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25833829 |
agcttagctcagttggtaaagatattgcatattatatgcagg |
25833870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 29098687 - 29098740
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||| |||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
29098687 |
atatccccgtgaacttaactcagttggtagagatattgtatattatatgcaggg |
29098740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 48 - 93
Target Start/End: Complemental strand, 31673317 - 31673272
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31673317 |
tgtgagcttgtctcagttggtaaggatattgcatattatatgcagg |
31673272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 33607006 - 33606961
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
33607006 |
gtgaacttagctcaattggtagggatattgcattttatatgcaggg |
33606961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 52 - 94
Target Start/End: Complemental strand, 40910246 - 40910202
Alignment:
| Q |
52 |
agcttagctcagttggtaggg--atattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40910246 |
agcttagctcagttggtagggggatattgcatattatatgcaggg |
40910202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 43 - 88
Target Start/End: Complemental strand, 44685241 - 44685196
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
||||| |||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
44685241 |
atccccgtgagcttagcttagttggtagagatattgcatattatat |
44685196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 44764725 - 44764770
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | ||||||||| |
|
|
| T |
44764725 |
gtgagcttagctcagttggtagggacattgcataatttatgcaggg |
44764770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 50675809 - 50675764
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50675809 |
gtgagtttatctcagttggtagggatattgcatattatatacaggg |
50675764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 5641619 - 5641579
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
5641619 |
cggacacctcacttcttcacaattaaattgtgtgagctcta |
5641579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 43 - 83
Target Start/End: Original strand, 10349402 - 10349442
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatat |
83 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
10349402 |
atccccgtgagcttagctcagttgatagggatattgcatat |
10349442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 89
Target Start/End: Complemental strand, 12894597 - 12894557
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
12894597 |
gtgagcttaactcagttggtagggatattgcattttatatg |
12894557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 15975217 - 15975257
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
15975217 |
cggacactccacttcttcacaattaaattgtgtgagctcta |
15975257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 17218553 - 17218593
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
17218553 |
cggacactccacttctccacaatttaattgtgtgagctcta |
17218593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 17602681 - 17602641
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
17602681 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
17602641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 22472319 - 22472279
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
22472319 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
22472279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 25279064 - 25279024
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
25279064 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
25279024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 31587012 - 31587052
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
31587012 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
31587052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 32256559 - 32256519
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
32256559 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
32256519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 33606945 - 33606905
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
33606945 |
cggacactccacttctccacaatttaattgtgtgagctcta |
33606905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 39169758 - 39169809
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||| ||||||| |||| ||||||||||| ||||||||||| |
|
|
| T |
39169758 |
tatccctgtgagcttaactcagttagtagagatattgcata-tatatgcaggg |
39169809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 43 - 87
Target Start/End: Original strand, 39300381 - 39300425
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattata |
87 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
39300381 |
atccccgtgagcttagctcagttggtagggatattacattttata |
39300425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 39720000 - 39720040
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
39720000 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
39720040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 40963785 - 40963733
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||| |||||||| || ||||||||||| |||||||||||| |
|
|
| T |
40963785 |
tatccccgtgagcttaactcagttgataaggatattgcattttatatgcaggg |
40963733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 41936412 - 41936372
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
41936412 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
41936372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 45118644 - 45118688
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
45118644 |
tgagcttagctcagttggtagggacattgcattatatatgcaggg |
45118688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 50 - 94
Target Start/End: Complemental strand, 51155158 - 51155114
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||| |||| |
|
|
| T |
51155158 |
tgagcttagctcagttggtaggaatattggatattatatgtaggg |
51155114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 51425836 - 51425888
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||| ||| |||||||||||| |
|
|
| T |
51425836 |
tatccccgtgagcttaactcagttggtagggatatcacattttatatgcaggg |
51425888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 53432742 - 53432702
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
53432742 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
53432702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 1743870 - 1743819
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||||||||| ||||||| |||| |
|
|
| T |
1743870 |
atccccgtgagcttaactcaattggtagggatattgcattttatatgtaggg |
1743819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 2007157 - 2007106
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||| |||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
2007157 |
tatccccgtgaacttaactcagttggtagaaatattgcatattatatgcagg |
2007106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 985 - 1060
Target Start/End: Complemental strand, 9730381 - 9730306
Alignment:
| Q |
985 |
atcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
||||||||| |||||||||||||||| || |||||| ||||| |||| ||||||||||||| ||||| ||||| |
|
|
| T |
9730381 |
atcattgtatttctctataaatagagctcatatgtaatctaattatacatgacaagagaataatataatcctcttt |
9730306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 94
Target Start/End: Complemental strand, 14644904 - 14644852
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
14644904 |
gatatccacgtgagcttagct--gttggtagggatattgcattttatatgcaggg |
14644852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 15299075 - 15299118
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||| |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
15299075 |
gtgagtttagttcagttggtagggatattgtatattatatgcag |
15299118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 94
Target Start/End: Original strand, 15491862 - 15491901
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15491862 |
ttagctcagttggtagaaatattgcatattatatgcaggg |
15491901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 17765580 - 17765623
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||||||||| | |||||||||||||||| ||||||||||||| |
|
|
| T |
17765580 |
gtgagcttagcccggttggtagggatattgtatattatatgcag |
17765623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 19066900 - 19066943
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||||||||| | |||||||||||||||| ||||||||||||| |
|
|
| T |
19066900 |
gtgagcttagcccggttggtagggatattgtatattatatgcag |
19066943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 92
Target Start/End: Original strand, 22857401 - 22857440
Alignment:
| Q |
53 |
gcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
22857401 |
gcttaactcagttggtaggaatattgcatattatatgcag |
22857440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 94
Target Start/End: Original strand, 26259138 - 26259177
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
26259138 |
ttagctcaattggtagggatatcgcatattatatgcaggg |
26259177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 96 - 135
Target Start/End: Complemental strand, 28689677 - 28689638
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctct |
135 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
28689677 |
cggacactccacttctccacaatttaattgtgtgagctct |
28689638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 136
Target Start/End: Complemental strand, 30779571 - 30779532
Alignment:
| Q |
97 |
ggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
30779571 |
ggacaccccacttctccacaatttaattgtgtgagttcta |
30779532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 36666458 - 36666509
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||| |||||||| ||| |||||| ||||||||||||||| |
|
|
| T |
36666458 |
atccccgtgagcttagttcagttggcaggaatattgtatattatatgcaggg |
36666509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 38562243 - 38562192
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||| |||| ||| || ||||||||||||||||||||||| |
|
|
| T |
38562243 |
tatccatgtgagcttacctcaattgataaggatattgcatattatatgcagg |
38562192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 90
Target Start/End: Complemental strand, 40723725 - 40723686
Alignment:
| Q |
51 |
gagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
40723725 |
gagcttaactcagttggtagggatattgcatgttatatgc |
40723686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 42541893 - 42541839
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtaggga--tattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||| ||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
42541893 |
tatccatgtgaacttagctcagttggtagagagatattgcatattatatgcaggg |
42541839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 42920720 - 42920669
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||| |||| |||||||||||| |
|
|
| T |
42920720 |
atccctgtgaatttagctcagttggtaggaatatcgcattttatatgcaggg |
42920669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 92
Target Start/End: Complemental strand, 44945728 - 44945685
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| |||||||||||| |
|
|
| T |
44945728 |
gtgagcttatctcagttggtaggaatattgcgtattatatgcag |
44945685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 45513069 - 45513018
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| || |||||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
45513069 |
tatccccgtaagcttagctcagttagtatggatattgcatattatatacagg |
45513018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 92
Target Start/End: Complemental strand, 46730840 - 46730797
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||||||||||||||| |||| |||| ||||||||||||||| |
|
|
| T |
46730840 |
gtgagcttagctcagttgataggcatatagcatattatatgcag |
46730797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 136
Target Start/End: Complemental strand, 50675746 - 50675707
Alignment:
| Q |
97 |
ggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
50675746 |
ggacaccccacttctccacaattaaattgtgtgagctcta |
50675707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 51467173 - 51467224
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||| ||||||||||||| ||||||||| |||| |||||||||||| |
|
|
| T |
51467173 |
atccccgtgaacttagctcagttgatagggatatcgcattttatatgcaggg |
51467224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 91
Target Start/End: Complemental strand, 55066662 - 55066619
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
55066662 |
tgtgagcttagctcagttggtacggataatgcataatatatgca |
55066619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 1697915 - 1697869
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcata-ttatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
1697915 |
gtgagcttaactcagttagtagggatattgcatatttatatgcaggg |
1697869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 48 - 94
Target Start/End: Complemental strand, 3614148 - 3614102
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| | ||||||||| |
|
|
| T |
3614148 |
tgtgagcttagctctgttggtagggacattgcataatttatgcaggg |
3614102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 4237051 - 4237001
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||||| |||||||||||||| |||||||| | ||||||||| |
|
|
| T |
4237051 |
tccccgtgagcttagttcagttggtagggacattgcataatttatgcaggg |
4237001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 4860228 - 4860266
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
4860228 |
gacaccccacttctccacaattaaattgtgtgagctcta |
4860266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 4880236 - 4880274
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
4880236 |
gacaccccacttctccacaattaaattgtgtgagctcta |
4880274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 6488191 - 6488229
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
6488191 |
gacactccacttctccacaatttaattgtgtgagctcta |
6488229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 7974573 - 7974531
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
7974573 |
gtgagcttagctcagttggtatggataatgcataatatatgca |
7974531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 11234439 - 11234489
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||| |||| ||||||| || ||||||||||| |
|
|
| T |
11234439 |
atccccgtgagcttagctcagttagtagagatattgtattttatatgcagg |
11234489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 88
Target Start/End: Complemental strand, 16895304 - 16895258
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
|||||| | ||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
16895304 |
tatccccgagagcttaactcagttggtaggaatattgcatattatat |
16895258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 18870786 - 18870744
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
18870786 |
gtgagcttagctcagttggtagggacaatgcataatatatgca |
18870744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Complemental strand, 22501934 - 22501896
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
22501934 |
gacactccacttctccacaatttaattgtgtgagctcta |
22501896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 75
Target Start/End: Original strand, 23953776 - 23953806
Alignment:
| Q |
45 |
ccctgtgagcttagctcagttggtagggata |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23953776 |
ccctgtgagcttagctcagttggtagggata |
23953806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 24303388 - 24303438
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| |||||||| | ||||||||| |
|
|
| T |
24303388 |
tccccgtgagcttagctcagttggcagggacattgcataatttatgcaggg |
24303438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 95
Target Start/End: Original strand, 25488888 - 25488934
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||||||||||| ||||| |
|
|
| T |
25488888 |
gtgagcttaactcagttgttagggatattacatattatatgtaggga |
25488934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 94
Target Start/End: Complemental strand, 25954869 - 25954816
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||| ||||| |||||||| |||||| |||||| ||||||||||||||||| |
|
|
| T |
25954869 |
gatatccc-gtgaggttagctcaattggtatggatatcgcatattatatgcaggg |
25954816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 88
Target Start/End: Complemental strand, 29496172 - 29496134
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
29496172 |
tgagtttaactcagttggtagggatattgcatattatat |
29496134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 31922353 - 31922403
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||| ||||||||||| | ||||||||||||||||||||| |
|
|
| T |
31922353 |
atccccgtgagcttgtctcagttggtaagaatattgcatattatatgcagg |
31922403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 32429814 - 32429852
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
32429814 |
gacaccccacttctccacaattaaattgtgtgagctcta |
32429852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Complemental strand, 39966077 - 39966039
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
39966077 |
gacactccacttctccacaatttaattgtgtgagctcta |
39966039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 976 - 1018
Target Start/End: Original strand, 43508537 - 43508579
Alignment:
| Q |
976 |
ttaagtcatatcattgtacttctctataaatagagaccacatg |
1018 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
43508537 |
ttaaatcatatcattgtacttctctataaataaagatcacatg |
43508579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 48315085 - 48315043
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
48315085 |
gtgagcttagctcagttggtaaggataatgcataatatatgca |
48315043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Complemental strand, 51155095 - 51155057
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
51155095 |
gacaccccacttctccacaattaaattgtgtgagctcta |
51155057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 94
Target Start/End: Complemental strand, 54349892 - 54349862
Alignment:
| Q |
64 |
ttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
54349892 |
ttggtagggatattgcatattatatgcaggg |
54349862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 137
Target Start/End: Complemental strand, 2007088 - 2007047
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctctat |
137 |
Q |
| |
|
||||||| |||||||| ||||||| ||||||||||||||||| |
|
|
| T |
2007088 |
cggacactccacttctccacaattaaattgtgtgagctctat |
2007047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 882 - 996
Target Start/End: Complemental strand, 3077360 - 3077243
Alignment:
| Q |
882 |
tggatgtccataaacccttgtatttatctcttaagtgacaacatattacttttcttttaagtcacacctatttgtatttattct----tacttaactctt |
977 |
Q |
| |
|
|||| ||||| | |||||||| |||||||||||||||||| ||| |||||| ||| ||| |||||| | ||| || |||| || |||||||||| | |
|
|
| T |
3077360 |
tggaagtccacatacccttgt-tttatctcttaagtgacatcattttacttatctcctaaatcacacatttttatacttatccttaaatacttaactcct |
3077262 |
T |
 |
| Q |
978 |
aagtcatatcattgtactt |
996 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
3077261 |
aagtcatatcatcgtactt |
3077243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 4227811 - 4227766
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| | ||||||||| |
|
|
| T |
4227811 |
gtgagtttagctcagttggtagggacattgcataatttatgcaggg |
4227766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 136
Target Start/End: Complemental strand, 4640482 - 4640445
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
4640482 |
acactccacttcttcacaattaaattgtgtgagctcta |
4640445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 7938363 - 7938318
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||| ||||||| |||| |
|
|
| T |
7938363 |
gtgagcttaactcagttggtagggatattacattttatatgtaggg |
7938318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 11236494 - 11236449
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||| ||||||| | |||||||||||| |
|
|
| T |
11236494 |
gtgagtttagctcagttggtaggaatattgctttttatatgcaggg |
11236449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 13644767 - 13644722
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
13644767 |
gtgagtttatctcaattggtagggatattgtatattatatgcaggg |
13644722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 93
Target Start/End: Original strand, 14795109 - 14795158
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||| |||||||||||| ||||||||| || |||||||| |||||||||| |
|
|
| T |
14795109 |
tccccgtgagcttagcttagttggtagtgacattgcataatatatgcagg |
14795158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 50 - 91
Target Start/End: Original strand, 19882689 - 19882730
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
19882689 |
tgagtttagctcggttggtagggatattgcatgttatatgca |
19882730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 136
Target Start/End: Original strand, 24430217 - 24430254
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
24430217 |
acaccccacttctccacaattaaattgtgtgagctcta |
24430254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 30185050 - 30185095
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||| |||||||||| | |||||||||||||||||||||| |
|
|
| T |
30185050 |
gtgagtttagttcagttggtatgcatattgcatattatatgcaggg |
30185095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 136
Target Start/End: Complemental strand, 38819326 - 38819289
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
38819326 |
acactccacttctccacaatttaattgtgtgagctcta |
38819289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 54 - 95
Target Start/End: Complemental strand, 46176864 - 46176823
Alignment:
| Q |
54 |
cttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||| |||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
46176864 |
cttaactcaattggtatggatattgcatattatatgcaggga |
46176823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 50 - 91
Target Start/End: Original strand, 49728702 - 49728743
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||| |||| |||||||||||||||||| ||||||||| |
|
|
| T |
49728702 |
tgagcttaactcaattggtagggatattgcattttatatgca |
49728743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 50659593 - 50659638
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||||||||||||| ||| |||||||||||| |
|
|
| T |
50659593 |
gtgagcttaactcagttggtagggatatcacattttatatgcaggg |
50659638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 60 - 93
Target Start/End: Complemental strand, 51152683 - 51152650
Alignment:
| Q |
60 |
tcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
51152683 |
tcagttggtagggatgttgcatattatatgcagg |
51152650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 55 - 88
Target Start/End: Complemental strand, 52434728 - 52434695
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
52434728 |
ttagttcagttggtagggatattgcatattatat |
52434695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 95 - 136
Target Start/End: Complemental strand, 54769836 - 54769796
Alignment:
| Q |
95 |
acggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
54769836 |
acggacaccccacttctccaca-tttaattgtgtgagctcta |
54769796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 51; Significance: 1e-19; HSPs: 3)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 40 - 94
Target Start/End: Original strand, 46520 - 46574
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46520 |
gatatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
46574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 11997 - 12041
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11997 |
gtgaacttagctcagttggtagggatattgcatattatatgcagg |
12041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #3
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 2566 - 2521
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||| ||| ||||||||| |||| |||||||||||| |
|
|
| T |
2566 |
gtgagcttagctcaattgttagggatatcgcattttatatgcaggg |
2521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1185 (Bit Score: 50; Significance: 5e-19; HSPs: 1)
Name: scaffold1185
Description:
Target: scaffold1185; HSP #1
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 43 - 136
Target Start/End: Complemental strand, 2446 - 2358
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagggacggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||| ||| || |||||||| ||||||| |||||||||||||||| |
|
|
| T |
2446 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca-----ggagactccacttctccacaattaaattgtgtgagctcta |
2358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 50; Significance: 5e-19; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 40 - 93
Target Start/End: Original strand, 59777 - 59830
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
59777 |
gatatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
59830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 5e-19; HSPs: 185)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 9877342 - 9877289
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877342 |
atatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
9877289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 15238884 - 15238937
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15238884 |
atatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
15238937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 969 - 1048
Target Start/End: Original strand, 9506706 - 9506786
Alignment:
| Q |
969 |
ttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaacataattgt-acaccacaagagaataat |
1048 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||| |||| || |||||||| |||||| |
|
|
| T |
9506706 |
ttaactcttaagttatatcactgtacttctctataaatagagatcacatgtaacatatttgtaacgccacaagaaaataat |
9506786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 19753042 - 19752990
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19753042 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
19752990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 32677017 - 32676965
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32677017 |
atatccctttgagcttagctcagttggtagggatattgcatattatatgcagg |
32676965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 41 - 93
Target Start/End: Original strand, 44616597 - 44616649
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44616597 |
atatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
44616649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 48119466 - 48119518
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48119466 |
tatccctgtgagcttagctcagttggtagggatattgcattttatatgcaggg |
48119518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 2228972 - 2229023
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2228972 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
2229023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 2681092 - 2681143
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2681092 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
2681143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 23102631 - 23102580
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23102631 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
23102580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 25833552 - 25833603
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25833552 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
25833603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 29617401 - 29617452
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29617401 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
29617452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 35950124 - 35950175
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35950124 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
35950175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 864 - 962
Target Start/End: Complemental strand, 9018887 - 9018790
Alignment:
| Q |
864 |
tgttatgaatataacaagtggatgtccataaacccttgtatttatctcttaagtgacaacatattacttttcttttaagtcacacctatttgtatttat |
962 |
Q |
| |
|
|||||||||||| | ||||||||||||| |||||| |||| |||||| ||||||||| ||||||| || || ||||||||||||||||||||| |||| |
|
|
| T |
9018887 |
tgttatgaatattataagtggatgtccacaaacccatgtacttatctattaagtgacgtcatattaattatc-tttaagtcacacctatttgtacttat |
9018790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 12640662 - 12640612
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12640662 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
12640612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 42443686 - 42443736
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42443686 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
42443736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 30388574 - 30388529
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30388574 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
30388529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 42 - 91
Target Start/End: Original strand, 39098132 - 39098181
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39098132 |
tatccctgtgagcttagttcagttggtagggatattgcatattatatgca |
39098181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 41084042 - 41084087
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41084042 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
41084087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 12772118 - 12772162
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12772118 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
12772162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 24781033 - 24781077
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24781033 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
24781077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 27510324 - 27510280
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27510324 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
27510280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 36174393 - 36174437
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36174393 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
36174437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 36391971 - 36391927
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36391971 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
36391927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 47641041 - 47641093
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47641041 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgtaggg |
47641093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 5990219 - 5990168
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5990219 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatgcagg |
5990168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 89
Target Start/End: Complemental strand, 10244963 - 10244916
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10244963 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
10244916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 15106765 - 15106714
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15106765 |
tatcccggtgagcttaactcagttggtagggatattgcatattatatgcagg |
15106714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 24061403 - 24061352
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24061403 |
tatccccgtgagcttagctcagttggtaggaatattgcatattatatgcagg |
24061352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 27424836 - 27424887
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27424836 |
atccccgtgagcttagctcagttggaagggatattgcatattatatgcaggg |
27424887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 30806112 - 30806163
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30806112 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggg |
30806163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 46 - 93
Target Start/End: Complemental strand, 32984287 - 32984240
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32984287 |
cctgtgagcttagctcagttggtagggatattgcatattatatacagg |
32984240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 37300172 - 37300121
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37300172 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgtaggg |
37300121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 38889566 - 38889515
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38889566 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggg |
38889515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 50 - 93
Target Start/End: Complemental strand, 46534814 - 46534771
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46534814 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
46534771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 557939 - 557865
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| |||||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
557939 |
tcattgtatttctctataaatagagttcatatgtaacctaattgtacatcacaagagaataatataatcctcttt |
557865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 576122 - 576048
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| |||||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
576122 |
tcattgtatttctctataaatagagttcatatgtaacctaattgtacatcacaagagaataatataatcctcttt |
576048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 3766808 - 3766858
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3766808 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
3766858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 42 - 92
Target Start/End: Original strand, 30940767 - 30940817
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30940767 |
tatccccgtgagcttagctcagttggtagtgatattgcatattatatgcag |
30940817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 31026216 - 31026266
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31026216 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
31026266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 52 - 94
Target Start/End: Original strand, 41465840 - 41465882
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41465840 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
41465882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 89
Target Start/End: Original strand, 47999777 - 47999823
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47999777 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
47999823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 9712265 - 9712220
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9712265 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggg |
9712220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 36389741 - 36389688
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
36389741 |
atatccccgtgagcttagctcagttggtagggatattgtattttatatgcaggg |
36389688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 28805304 - 28805348
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28805304 |
tgagcttagctcagttggtagggatattgcatatcatatgcaggg |
28805348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 34267618 - 34267574
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34267618 |
gtgagcttagctcagttggtaggaatattgcatattatatgcagg |
34267574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 35815834 - 35815886
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
35815834 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggg |
35815886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 36720110 - 36720154
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36720110 |
gtgagcttagctcagttggtagggatattgcatattatatacagg |
36720154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 48288468 - 48288424
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48288468 |
gtgagcttaactcagttggtagggatattgcatattatatgcagg |
48288424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 50 - 93
Target Start/End: Original strand, 4960788 - 4960831
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4960788 |
tgagcttagctcagttagtagggatattgcatattatatgcagg |
4960831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 41 - 92
Target Start/End: Complemental strand, 9929979 - 9929928
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9929979 |
atatccccgttagcttagctcagttggtagggatattgaatattatatgcag |
9929928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 21066883 - 21066934
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21066883 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgtaggg |
21066934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 50 - 93
Target Start/End: Original strand, 21388527 - 21388570
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21388527 |
tgagcgtagctcagttggtagggatattgcatattatatgcagg |
21388570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 966 - 1025
Target Start/End: Original strand, 22527733 - 22527792
Alignment:
| Q |
966 |
tacttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaacata |
1025 |
Q |
| |
|
||||||||||||| ||||||||||| || ||||||||||||||| | ||||||||||||| |
|
|
| T |
22527733 |
tacttaactcttatgtcatatcattatatttctctataaatagatatcacatgtaacata |
22527792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 24692471 - 24692522
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24692471 |
tatccccgtgaggttagctcagttggtagggatattgcatattctatgcagg |
24692522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 46 - 89
Target Start/End: Complemental strand, 24732621 - 24732578
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24732621 |
cctgtgagcttagctcagttgttagggatattgcatattatatg |
24732578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 29625924 - 29625967
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29625924 |
gtgagcttaactcagttggtagggatattgcatattatatgcag |
29625967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 36469779 - 36469728
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
36469779 |
tatccccgtgagcttagctcagttggtagggatattacatattacatgcagg |
36469728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 48 - 94
Target Start/End: Complemental strand, 13730165 - 13730119
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
13730165 |
tgtgagcttagcttagttggtagagatattgcatattatatgcaggg |
13730119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 966 - 1048
Target Start/End: Original strand, 29204841 - 29204922
Alignment:
| Q |
966 |
tacttaactcttaagtcatatcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataat |
1048 |
Q |
| |
|
||||||||| |||||| || || || ||| ||||||||||||||||||| ||||||||| |||| | |||||||||||||||| |
|
|
| T |
29204841 |
tacttaactattaagttatctccttatacatctctataaatagagaccatatgtaacat-attgaataccacaagagaataat |
29204922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 33996954 - 33996904
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33996954 |
atccccgtgagtatagctcagttggtagggatattgcatattatatgcagg |
33996904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 10690 - 10645
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10690 |
gtgatcttagcttagttggtagggatattgcatattatatgcaggg |
10645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 95
Target Start/End: Original strand, 5073263 - 5073316
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||||| ||||||||| |||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
5073263 |
tatccccgtgagcttaactcagttggtagagatattgtatattatatgcaggga |
5073316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 91
Target Start/End: Original strand, 5804851 - 5804900
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
5804851 |
tatccctgtaagcttagcttagttggtagggatattgcattttatatgca |
5804900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 12264057 - 12264102
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12264057 |
gtgaacttagctcagttggtagggatattgcattttatatgcaggg |
12264102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 50 - 95
Target Start/End: Original strand, 15655708 - 15655753
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
15655708 |
tgagcttagctcaattggtagggatattgcattttatatgcaggga |
15655753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 23755089 - 23755036
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||||||||||||| | ||||||||||||||||||| ||||||||| |
|
|
| T |
23755089 |
atatccccgtgagcttagctcaatcggtagggatattgcatattttatgcaggg |
23755036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 24062078 - 24062033
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
24062078 |
gtgagcttagctcagttagtagggatattgcatattatatgtaggg |
24062033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 24188473 - 24188518
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24188473 |
gtgagcatagctcagttggtagggatactgcatattatatgcaggg |
24188518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 52 - 93
Target Start/End: Complemental strand, 24880516 - 24880475
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24880516 |
agcttagctcagttggtagggatattgaatattatatgcagg |
24880475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 35683194 - 35683149
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
35683194 |
gtgagcttagctcagttggtagggatatcgcattttatatgcaggg |
35683149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 38824692 - 38824647
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
38824692 |
gtgagcttagctcagttgatagggatattgcgtattatatgcaggg |
38824647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 42182265 - 42182220
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42182265 |
gtgagcttaactcagttggtaggggtattgcatattatatgcaggg |
42182220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 47 - 96
Target Start/End: Original strand, 49053996 - 49054045
Alignment:
| Q |
47 |
ctgtgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
|||||||||||| |||||||||| | |||||||||||||||||||||||| |
|
|
| T |
49053996 |
ctgtgagcttagttcagttggtacgaatattgcatattatatgcagggac |
49054045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 58 - 94
Target Start/End: Complemental strand, 1563797 - 1563761
Alignment:
| Q |
58 |
gctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1563797 |
gctcagttggtagggatattgcatattatatgcaggg |
1563761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 9233836 - 9233784
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
9233836 |
tatccccgtgagcttaactcagttggtagggatattgaattttatatgcaggg |
9233784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 12615755 - 12615799
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12615755 |
tgagcttaactcagttgatagggatattgcatattatatgcaggg |
12615799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 56 - 96
Target Start/End: Complemental strand, 15074962 - 15074922
Alignment:
| Q |
56 |
tagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15074962 |
tagctcagttgatagggatattgcatattatatgcagggac |
15074922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 15694546 - 15694598
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15694546 |
tatccccgtgagcttaattcagttggtagggatattgtatattatatgcaggg |
15694598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 15701526 - 15701578
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15701526 |
tatccccgtgagcttaattcagttggtagggatattgtatattatatgcaggg |
15701578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 89
Target Start/End: Complemental strand, 18223784 - 18223744
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18223784 |
gtgagcttaactcagttggtagggatattgcatattatatg |
18223744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 21762966 - 21762914
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||| |||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21762966 |
tatccccgtgaacttatctcagttggtaaggatattgcatattatatgcaggg |
21762914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 26801804 - 26801752
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26801804 |
atatccccgtgagtatagctcagttggtaggaatattgcatattatatgcagg |
26801752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 27704373 - 27704321
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||| |||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27704373 |
tatccccgtgaacttaactcagttggtaggaatattgcatattatatgcaggg |
27704321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 32074469 - 32074417
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
32074469 |
tatccccgtgagcttagctcagttggtagggatatcacattttatatgcaggg |
32074417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 43 - 91
Target Start/End: Original strand, 36622171 - 36622219
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||| |||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36622171 |
atccccgtgaacttagctcaattggtagggatattgcatattatatgca |
36622219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 48414001 - 48413949
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||| ||||||||||||||||| |||| || |||||||||||||||||||||| |
|
|
| T |
48414001 |
atatgcctgtgagcttagctcaattggcagagatattgcatattatatgcagg |
48413949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 44 - 91
Target Start/End: Original strand, 5833037 - 5833084
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
5833037 |
tccccgtgagcttagctcagttggtagggataatgcataatatatgca |
5833084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 7525441 - 7525492
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||| |||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
7525441 |
atccccgtgagtttagttcagttggtaaggatattgcatattatatgcaggg |
7525492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 10226672 - 10226723
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||| |||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10226672 |
atccccgtgagtttagttcagttggtagggatgttgcatattatatgcaggg |
10226723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 55 - 94
Target Start/End: Original strand, 13720779 - 13720818
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13720779 |
ttagctcagttggttgggatattgcatattatatgcaggg |
13720818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 16200556 - 16200607
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
16200556 |
atcccggtgagcttagcttaattggtaggaatattgcatattatatgcaggg |
16200607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 23817185 - 23817236
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| ||||||| |||| |
|
|
| T |
23817185 |
atccctgtgagcttaactcaattggtagggatattgcatgttatatgtaggg |
23817236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 42 - 89
Target Start/End: Original strand, 24508822 - 24508869
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
24508822 |
tatcccagtgagcgtagttcagttggtagggatattgcatattatatg |
24508869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 44 - 91
Target Start/End: Complemental strand, 26816730 - 26816683
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
26816730 |
tccccgtgagcttagctcagttggtagggataatgcataatatatgca |
26816683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 55 - 94
Target Start/End: Original strand, 27633940 - 27633979
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27633940 |
ttagcttagttggtagggatattgcatattatatgcaggg |
27633979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 48 - 87
Target Start/End: Original strand, 28735730 - 28735769
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattata |
87 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28735730 |
tgtgagcttaactcagttggtagggatattgcatattata |
28735769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 50 - 93
Target Start/End: Original strand, 35645603 - 35645646
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35645603 |
tgagcgtagctcagttggtagggatattgtatattatatgcagg |
35645646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 48 - 95
Target Start/End: Complemental strand, 44377113 - 44377066
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||||||||| |||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
44377113 |
tgtgagcttaactcagttggtagagatattacatattatatgcaggga |
44377066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 48 - 95
Target Start/End: Complemental strand, 44385980 - 44385933
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||||||||| |||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
44385980 |
tgtgagcttaactcagttggtagagatattacatattatatgcaggga |
44385933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 54 - 93
Target Start/End: Original strand, 48719807 - 48719846
Alignment:
| Q |
54 |
cttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48719807 |
cttagctcagttggtaggaatattgcatattatatgcagg |
48719846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 52 - 94
Target Start/End: Complemental strand, 1398967 - 1398925
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1398967 |
agcttaactcagttggttgggatattgcatattatatgcaggg |
1398925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 42 - 96
Target Start/End: Original strand, 3529776 - 3529830
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagggac |
96 |
Q |
| |
|
|||||| ||||| ||| ||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
3529776 |
tatccccgtgagtttaactcagttggtagggatattgcattttatatacagggac |
3529830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 95
Target Start/End: Original strand, 7876002 - 7876048
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | |||||||||| |
|
|
| T |
7876002 |
gtgagcttagctcagttggtagggacattgcataatttatgcaggga |
7876048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 16648515 - 16648589
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||| ||| ||||| ||||| |
|
|
| T |
16648515 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaaaaatataatcctcttt |
16648589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 17622876 - 17622950
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| |||||||||| ||| ||||| ||||| |
|
|
| T |
17622876 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagagaaaaatataatcctcttt |
17622950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1048
Target Start/End: Original strand, 25493931 - 25493993
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataat |
1048 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||||||| |||| |||||||||||||| |
|
|
| T |
25493931 |
tcattgtatttctctataaatagagctcatatgtaacataatgatacatcacaagagaataat |
25493993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 27679077 - 27679035
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
27679077 |
gtgagcttaactcagttggtatggatattgcatattatatgca |
27679035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 95
Target Start/End: Complemental strand, 31191667 - 31191621
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31191667 |
gtgagcttaattcagttggtaaggatattgcatattatatgcaggga |
31191621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 50 - 92
Target Start/End: Complemental strand, 35612633 - 35612591
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
35612633 |
tgagcttagctcaattggtagggagattgcatattatatgcag |
35612591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 48 - 94
Target Start/End: Original strand, 38151346 - 38151392
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
38151346 |
tgtgagcttagctcagttggtagggatattgcattatttatgcaggg |
38151392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 3532581 - 3532626
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3532581 |
gtgatcttagttcagttggtagggatattgcataatatatgcaggg |
3532626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 9497961 - 9498014
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| | ||| |||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
9497961 |
atatccccgcgagtttagctcaattggtagggatattgcatattatatgtaggg |
9498014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 50 - 91
Target Start/End: Complemental strand, 15716751 - 15716710
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15716751 |
tgagtttagctcagttggtagggatattgcgtattatatgca |
15716710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 43 - 88
Target Start/End: Complemental strand, 30004622 - 30004577
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
30004622 |
atccttgtgaacttagctcagttggtagggatattacatattatat |
30004577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 60 - 93
Target Start/End: Complemental strand, 31769568 - 31769535
Alignment:
| Q |
60 |
tcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31769568 |
tcagttggtagggatattgcatattatatgcagg |
31769535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 32856984 - 32856939
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
32856984 |
gtgaacttagcttaattggtagggatattgcatattatatgcaggg |
32856939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 34051941 - 34051896
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34051941 |
gtgagtttagttcagttggtagtgatattgcatattatatgcaggg |
34051896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 2023519 - 2023559
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
2023519 |
cggacactccacttcttcacaattaaattgtgtgagctcta |
2023559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 7401454 - 7401410
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
7401454 |
gtgagtttaactcagttggtagggatattgtatattatatgcagg |
7401410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 46 - 86
Target Start/End: Original strand, 7691872 - 7691912
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattat |
86 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
7691872 |
cctgtgagtttagttcagttggtagggatattgcatattat |
7691912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 10244894 - 10244854
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
10244894 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
10244854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 19331505 - 19331465
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
19331505 |
cggacactccacttctccacaatttaattgtgtgagctcta |
19331465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 26801734 - 26801694
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
26801734 |
cggacactccacttcttcacaattaaattgtgtgagctcta |
26801694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 26944232 - 26944184
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||| ||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
26944232 |
cctgtgagtttagctcagccggtaggaatattgcatattatatgcaggg |
26944184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 28424336 - 28424296
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28424336 |
cggaaaccccacttcttcacaattaaattgtgtgagctcta |
28424296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 43 - 91
Target Start/End: Complemental strand, 35835772 - 35835724
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| | || ||||||||| |
|
|
| T |
35835772 |
atccctgtgagcttagctcagttagtagggatatcgtattttatatgca |
35835724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 89
Target Start/End: Original strand, 41699642 - 41699682
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
41699642 |
gtgagcttagctcagttagtagggatattgcatatcatatg |
41699682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 48119535 - 48119575
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
48119535 |
cggacactccacttctccacaatttaattgtgtgagctcta |
48119575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 82
Target Start/End: Original strand, 4611240 - 4611275
Alignment:
| Q |
47 |
ctgtgagcttagctcagttggtagggatattgcata |
82 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4611240 |
ctgtgagcttagctcagttggtagggacattgcata |
4611275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 91
Target Start/End: Original strand, 5579692 - 5579735
Alignment:
| Q |
48 |
tgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
5579692 |
tgtgagcttagctcagttggtagggacagtgcataatatatgca |
5579735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 94
Target Start/End: Original strand, 11745196 - 11745235
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
11745196 |
ttagctcagttggtagagatattgcattttatatgcaggg |
11745235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 92
Target Start/End: Complemental strand, 16961691 - 16961648
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||| |||||||||||||||||||||||| || |||||||||| |
|
|
| T |
16961691 |
gtgagtttagctcagttggtagggatattgtattttatatgcag |
16961648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 95
Target Start/End: Original strand, 18677022 - 18677073
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||||||||| ||| ||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
18677022 |
tccctgtgagtttaactcagttggtatggacgttgcatattatatgcaggga |
18677073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 19828129 - 19828172
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
19828129 |
gtgaacttagctcagttggtagggatatcgcattttatatgcag |
19828172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 91
Target Start/End: Original strand, 24991776 - 24991823
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | |||||| |||||||| |
|
|
| T |
24991776 |
tccctgtgagcttagctcagttggtaaggacaatgcataatatatgca |
24991823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 91
Target Start/End: Complemental strand, 27068215 - 27068176
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
27068215 |
agcttagctcagttggtatggataatgcatattatatgca |
27068176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 91
Target Start/End: Original strand, 27210098 - 27210137
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
27210098 |
agcttagctcagttggtatggataatgcatattatatgca |
27210137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 92
Target Start/End: Complemental strand, 28424394 - 28424355
Alignment:
| Q |
53 |
gcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
28424394 |
gcttagctcagtttgtagggaaattgcatattatatgcag |
28424355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 28444155 - 28444104
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||| |||||||||||| ||||| |||| |||||||||||| |
|
|
| T |
28444155 |
atccccgtgagcttaactcagttggtagagatatcgcattttatatgcaggg |
28444104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 91
Target Start/End: Complemental strand, 28602529 - 28602490
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
28602529 |
agcttagctcagttggtaggaatattacatattatatgca |
28602490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 95 - 134
Target Start/End: Complemental strand, 31727798 - 31727759
Alignment:
| Q |
95 |
acggacaccccacttcttcacaatttaattgtgtgagctc |
134 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
31727798 |
acggacactccacttctccacaatttaattgtgtgagctc |
31727759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 95
Target Start/End: Complemental strand, 39829230 - 39829187
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||||| ||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
39829230 |
agcttaactcagttggtaggaatattgcattttatatgcaggga |
39829187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 94
Target Start/End: Complemental strand, 41913829 - 41913786
Alignment:
| Q |
51 |
gagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| |||||||||||| |
|
|
| T |
41913829 |
gagcttagctcagttgatagagatattgcattttatatgcaggg |
41913786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 136
Target Start/End: Complemental strand, 43119436 - 43119397
Alignment:
| Q |
97 |
ggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
43119436 |
ggacaccccacttctccacaattaaattgtgtgagctcta |
43119397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 3392465 - 3392515
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||| |||||||| || ||||||||||||||||||| |||| |
|
|
| T |
3392465 |
tccccgtgagcttaactcagttgatatggatattgcatattatatgtaggg |
3392515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 93
Target Start/End: Original strand, 8174129 - 8174163
Alignment:
| Q |
59 |
ctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8174129 |
ctcagttggtagggatattgcattttatatgcagg |
8174163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 1012 - 1066
Target Start/End: Complemental strand, 9018754 - 9018700
Alignment:
| Q |
1012 |
ccacatgtaacataattgtacaccacaagagaataatgtaatcatctttgtttct |
1066 |
Q |
| |
|
||||||||||||||||| ||||| | ||||||||||| ||||||| | ||||||| |
|
|
| T |
9018754 |
ccacatgtaacataattatacactaaaagagaataatataatcatttatgtttct |
9018700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 9684619 - 9684669
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
9684619 |
atccctgtaaacttagttcagttggtagggatatcacatattatatgcagg |
9684669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Complemental strand, 9697894 - 9697856
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
9697894 |
gacactccacttctacacaatttaattgtgtgagctcta |
9697856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 94
Target Start/End: Original strand, 10690857 - 10690895
Alignment:
| Q |
56 |
tagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
10690857 |
tagctcagctgatagggatattgcatattatatgcaggg |
10690895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 88
Target Start/End: Original strand, 12364745 - 12364791
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
|||||| ||||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
12364745 |
tatccccgtgagcttaactcacttggtagggatattgtatattatat |
12364791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 19331570 - 19331520
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||||||| ||||||||| ||||||||||| ||||||||||| |
|
|
| T |
19331570 |
atccccgtgagcttagtgcagttggtacggatattgcattttatatgcagg |
19331520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 89
Target Start/End: Complemental strand, 19922169 - 19922123
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| |||||||||||| ||||| |||||||||||||| ||||||| |
|
|
| T |
19922169 |
atccccgtgagcttagcttagttgatagggatattgcattttatatg |
19922123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 88
Target Start/End: Complemental strand, 21402898 - 21402856
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatat |
88 |
Q |
| |
|
||||||||||||||| |||| |||||||||||| ||||||||| |
|
|
| T |
21402898 |
cctgtgagcttagcttagttagtagggatattgtatattatat |
21402856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 23274886 - 23274836
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||||||| |||||||||||| |||||||| | ||||||||| |
|
|
| T |
23274886 |
tccccgtgagcttagctaagttggtagggacattgcataatttatgcaggg |
23274836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 986 - 1048
Target Start/End: Original strand, 25499168 - 25499230
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataat |
1048 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| |||| |||| |||||||||||||| |
|
|
| T |
25499168 |
tcattgtatttctctataaatagagctcatatgtaacctaatgatacatcacaagagaataat |
25499230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 986 - 1060
Target Start/End: Original strand, 32148569 - 32148643
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| | ||||||| ||||| |||| ||||||| |||||| ||||| ||||| |
|
|
| T |
32148569 |
tcattgtatttctctataaatagagcttatatgtaacctaattatacatcacaagaaaataatataatcctcttt |
32148643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 89
Target Start/End: Original strand, 32619347 - 32619393
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||| ||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
32619347 |
atccccgtgagcttaactcagttgttaaggatattgcatattatatg |
32619393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 36931971 - 36932021
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||||||||| ||||| |||||||| | ||||||||| |
|
|
| T |
36931971 |
tccctgtgaacttagctcagttggcagggacattgcataatttatgcaggg |
36932021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 94
Target Start/End: Complemental strand, 40200173 - 40200131
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
40200173 |
agcttaactcagttggtagaaatattgcatattatatgcaggg |
40200131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 40518961 - 40518911
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||| |||||||||||||||||||| |||||||| |||||| |||| |
|
|
| T |
40518961 |
tccccgtgaacttagctcagttggtagggacattgcataatatatgtaggg |
40518911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 41853995 - 41854045
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| |||||||| | ||||||||| |
|
|
| T |
41853995 |
tccccgtgagcttagctcagttggcagggacattgcataatttatgcaggg |
41854045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 42167688 - 42167614
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| ||||||| ||||| ||||| ||||| |
|
|
| T |
42167688 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcacaagaaaataacataatcctcttt |
42167614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 42352648 - 42352698
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| |||||||| |||||||||||||||| ||||| || ||||||||||| |
|
|
| T |
42352648 |
tccccgtgagctttgctcagttggtagggacattgcctaatatatgcaggg |
42352698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 51 - 93
Target Start/End: Complemental strand, 43633155 - 43633113
Alignment:
| Q |
51 |
gagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
43633155 |
gagcttagctcagttgatagggatattatatattatatgcagg |
43633113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 39 - 93
Target Start/End: Complemental strand, 45640169 - 45640115
Alignment:
| Q |
39 |
ggatatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||| |||| ||||||||| || |||| |||||||||||| |||||||||||||| |
|
|
| T |
45640169 |
ggatttccccgtgagcttaacttagttagtagggatattgtatattatatgcagg |
45640115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 95
Target Start/End: Complemental strand, 47194499 - 47194445
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||| ||| |||||| ||||| |
|
|
| T |
47194499 |
atatccctgtgagcatagctcagttgacagggatattgtataatatatgtaggga |
47194445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 48719866 - 48719904
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
48719866 |
gacactccacttctccacaatttaattgtgtgagctcta |
48719904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 133
Target Start/End: Complemental strand, 5990151 - 5990114
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagct |
133 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
5990151 |
cggacactccacttctccacaatttaattgtgtgagct |
5990114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 133
Target Start/End: Complemental strand, 9712203 - 9712166
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagct |
133 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
9712203 |
cggacaccccacttctccacaattaaattgtgtgagct |
9712166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 129
Target Start/End: Original strand, 15694614 - 15694647
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtg |
129 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
15694614 |
cggacactccacttcttcacaatttaattgtgtg |
15694647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 129
Target Start/End: Original strand, 15701594 - 15701627
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtg |
129 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
15701594 |
cggacactccacttcttcacaatttaattgtgtg |
15701627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 53 - 94
Target Start/End: Complemental strand, 18503543 - 18503502
Alignment:
| Q |
53 |
gcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
18503543 |
gcttagctcggttggaagagatattgcatattatatgcaggg |
18503502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 136
Target Start/End: Original strand, 28501225 - 28501262
Alignment:
| Q |
99 |
acaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
28501225 |
acaccccacttctccacaattaaattgtgtgagctcta |
28501262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 54 - 91
Target Start/End: Complemental strand, 30003238 - 30003201
Alignment:
| Q |
54 |
cttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
30003238 |
cttagctcagttggtaaggatattacatattatatgca |
30003201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 137
Target Start/End: Complemental strand, 35683132 - 35683091
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctctat |
137 |
Q |
| |
|
||||||| |||||||| ||||||| ||||||||||||||||| |
|
|
| T |
35683132 |
cggacactccacttctccacaattaaattgtgtgagctctat |
35683091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 104 - 137
Target Start/End: Complemental strand, 38889490 - 38889457
Alignment:
| Q |
104 |
ccacttcttcacaatttaattgtgtgagctctat |
137 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
38889490 |
ccacttctccacaatttaattgtgtgagctctat |
38889457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 41331146 - 41331101
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| | ||||||||| |
|
|
| T |
41331146 |
gtgagcttagctcagttggcagggacattgcataatttatgcaggg |
41331101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 90
Target Start/End: Complemental strand, 42798383 - 42798342
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
||||||||| | ||||| |||||||||||||||||||||||| |
|
|
| T |
42798383 |
gtgagcttaacccagtttgtagggatattgcatattatatgc |
42798342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 88
Target Start/End: Original strand, 46243285 - 46243330
Alignment:
| Q |
44 |
tccctgtgagcttagctcagttggt-agggatattgcatattatat |
88 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| |||||||||||| |
|
|
| T |
46243285 |
tccctgtgagcttagctcatttggtaagggataatgcatattatat |
46243330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 47287931 - 47287886
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||| ||||||| |||| |
|
|
| T |
47287931 |
gtgagcttaactcagttggtagggatattacattttatatgtaggg |
47287886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 47463934 - 47463979
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||||||||||| |
|
|
| T |
47463934 |
gtgagcttaactcagttggtagaaatattgcatgttatatgcaggg |
47463979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 137
Target Start/End: Original strand, 47463996 - 47464037
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctctat |
137 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||| |||||| |
|
|
| T |
47463996 |
cggacaccccacttctccacaattaaattgtgtgatctctat |
47464037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 48447752 - 48447797
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||||||| ||||| |||| |||||||||||| |
|
|
| T |
48447752 |
gtgagcttaactcagttggtagagatatcgcattttatatgcaggg |
48447797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 48; Significance: 7e-18; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 94 - 43
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
94 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
43 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 48; Significance: 7e-18; HSPs: 2)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 10899 - 10848
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10899 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
10848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088; HSP #2
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 10831 - 10791
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
10831 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
10791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 48; Significance: 7e-18; HSPs: 3)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 266771 - 266720
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
266771 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
266720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 47 - 89
Target Start/End: Original strand, 173661 - 173702
Alignment:
| Q |
47 |
ctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
173661 |
ctgtgagcttagctcagttcgta-ggatattgcatattatatg |
173702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #3
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 47 - 89
Target Start/End: Original strand, 179174 - 179215
Alignment:
| Q |
47 |
ctgtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
179174 |
ctgtgagcttagctcagttcgta-ggatattgcatattatatg |
179215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 47; Significance: 3e-17; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 8963 - 9013
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8963 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
9013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 47; Significance: 3e-17; HSPs: 2)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 4087 - 4037
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4087 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
4037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445; HSP #2
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Complemental strand, 4017 - 3979
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
4017 |
gacactccacttctccacaatttaattgtgtgagctcta |
3979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 47; Significance: 3e-17; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 17617 - 17667
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17617 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
17667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 45; Significance: 4e-16; HSPs: 2)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 13273 - 13225
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13273 |
cctgtgcgcttagctcagttggtagggatattgcatattatatgcaggg |
13225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460; HSP #2
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 12456 - 12506
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12456 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
12506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 45; Significance: 4e-16; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 927 - 883
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
927 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 45; Significance: 4e-16; HSPs: 2)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 65857 - 65809
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
65857 |
cctgtgagcttagctcagttggtagggatattgcatattatatgtaggg |
65809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025; HSP #2
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 65792 - 65752
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
65792 |
cggacactccacttcttcacaatttaattgtgtgagctcta |
65752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 45; Significance: 4e-16; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 8899 - 8847
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8899 |
tatccccgtgagcttagctcagttggtagggatattgcatattttatgcaggg |
8847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 44; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 8818 - 8869
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8818 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgcaggg |
8869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 44; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 93
Target Start/End: Original strand, 112104 - 112155
Alignment:
| Q |
42 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
112104 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
112155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 43; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 12328 - 12286
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12328 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
12286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1372 (Bit Score: 42; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold1372
Description:
Target: scaffold1372; HSP #1
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 53 - 94
Target Start/End: Original strand, 1871 - 1912
Alignment:
| Q |
53 |
gcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1871 |
gcttagctcagttggtagggatattgcatattatatgcaggg |
1912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288 (Bit Score: 42; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 21267 - 21312
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21267 |
gtgagcttagcttagttggtagggatattgcatattatatgcaggg |
21312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 41; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 3669 - 3713
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3669 |
gtgagcttaactcagttggtagggatattgcatattatatgcagg |
3713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 41; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 15767 - 15811
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15767 |
gtgagcttatctcagttggtagggatattgcatattatatgcagg |
15811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 41; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 37481 - 37437
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37481 |
gtgagcttaactcagttggtagggatattgcatattatatgcagg |
37437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #2
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 23364 - 23407
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23364 |
gtgaacttaactcagttggtagggatattgcatattatatgcag |
23407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0100 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 43 - 86
Target Start/End: Original strand, 45881 - 45924
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattat |
86 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45881 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
45924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 39; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 55 - 93
Target Start/End: Complemental strand, 11181 - 11143
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11181 |
ttagctcagttggtagggatattgcatattatatgcagg |
11143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 55 - 93
Target Start/End: Complemental strand, 21509 - 21471
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21509 |
ttagctcagttggtagggatattgcatattatatgcagg |
21471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 38; Significance: 0.000000000007; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 41 - 94
Target Start/End: Original strand, 395 - 448
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||| ||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
395 |
atatccccgtgaacttagctcaattgatagggatattgcatattatatgcaggg |
448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 38; Significance: 0.000000000007; HSPs: 2)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 90
Target Start/End: Complemental strand, 3660 - 3619
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgc |
90 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3660 |
gtgagcttagctcagttggtagggatatttcatattatatgc |
3619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 94
Target Start/End: Complemental strand, 3701 - 3662
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
3701 |
ttagcttagttggtaaggatattgcatattatatgcaggg |
3662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 38; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 27997 - 27952
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
27997 |
gtgagcttagctcggttggtagggatattgcattttatatgcaggg |
27952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1709 (Bit Score: 37; Significance: 0.00000000003; HSPs: 1)
Name: scaffold1709
Description:
Target: scaffold1709; HSP #1
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 175 - 219
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
175 |
tgagcttagctcagttggtatagatattgcatattatatgcaggg |
219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1331 (Bit Score: 37; Significance: 0.00000000003; HSPs: 1)
Name: scaffold1331
Description:
Target: scaffold1331; HSP #1
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 50 - 94
Target Start/End: Complemental strand, 146 - 102
Alignment:
| Q |
50 |
tgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
146 |
tgagcttagctcagttggtatagatattgcatattatatgcaggg |
102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 36; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 94
Target Start/End: Complemental strand, 59243 - 59200
Alignment:
| Q |
51 |
gagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
59243 |
gagcttagttcagttggtagagatattgcatattatatgcaggg |
59200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 36; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 315646 - 315697
Alignment:
| Q |
43 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| |||| |||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
315646 |
atccccgtgaacttagctcagttggtaaggatattgcattttatatgcaggg |
315697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517 (Bit Score: 35; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0517
Description:
Target: scaffold0517; HSP #1
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 95
Target Start/End: Original strand, 4884 - 4930
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggga |
95 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
4884 |
gtgagcttggctcagttagtagggatattgcataatatatgcaggga |
4930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 35; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 6044 - 6082
Alignment:
| Q |
98 |
gacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6044 |
gacactccacttcttcacaatttaattgtgtgagctcta |
6082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 89
Target Start/End: Original strand, 5985 - 6025
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
5985 |
gtgagcttagctcatttgatagggatattgcatattatatg |
6025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 35; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 40 - 94
Target Start/End: Original strand, 56317 - 56371
Alignment:
| Q |
40 |
gatatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||| || ||||||||| |||| |||| |||||||||||||||||||||||||| |
|
|
| T |
56317 |
gatattcccgtgagcttaactcaattggcagggatattgcatattatatgcaggg |
56371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 35; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1060
Target Start/End: Complemental strand, 351059 - 350985
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatcatcttt |
1060 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||| ||||| |||| || ||||||||||| ||||| ||||| |
|
|
| T |
351059 |
tcattgtatttctctataaatagagctcatatgtaacctaattatacatcataagagaataatataatcctcttt |
350985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004; HSP #2
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 986 - 1054
Target Start/End: Complemental strand, 345738 - 345670
Alignment:
| Q |
986 |
tcattgtacttctctataaatagagaccacatgtaacataattgtacaccacaagagaataatgtaatc |
1054 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||| ||||| |||| || |||| |||||| ||||| |
|
|
| T |
345738 |
tcattgtatttctctataaatagagctcacatgtaacctaattatacatcataagaaaataatataatc |
345670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 34; Significance: 0.000000002; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 15008 - 15053
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | ||||||||| |
|
|
| T |
15008 |
gtgagcttagctcagttggtagggacattgcataatttatgcaggg |
15053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 34; Significance: 0.000000002; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 50068 - 50023
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||| |||| |
|
|
| T |
50068 |
gtgagcttaactcagttgatagggatattgcatattatatgtaggg |
50023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 34; Significance: 0.000000002; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 86
Target Start/End: Complemental strand, 236430 - 236385
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattat |
86 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
236430 |
atatccccgtgagattagttcagttggtagggatattgcatattat |
236385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0394 (Bit Score: 33; Significance: 0.000000006; HSPs: 1)
Name: scaffold0394
Description:
Target: scaffold0394; HSP #1
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 1265 - 1309
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||||||||| |||||| |||||||||||||| |
|
|
| T |
1265 |
gtgagcttaactcagttggtaggaatattgtatattatatgcagg |
1309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0330 (Bit Score: 33; Significance: 0.000000006; HSPs: 1)
Name: scaffold0330
Description:
Target: scaffold0330; HSP #1
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 89
Target Start/End: Original strand, 6771 - 6811
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatg |
89 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6771 |
gtgaacttaactcagttggtagggatattgcatattatatg |
6811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0294 (Bit Score: 33; Significance: 0.000000006; HSPs: 2)
Name: scaffold0294
Description:
Target: scaffold0294; HSP #1
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 17266 - 17226
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
17266 |
cggacactccacttcttcacaattaaattgtgtgagctcta |
17226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0294; HSP #2
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 17336 - 17283
Alignment:
| Q |
41 |
atatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||| |||| |||| |||||||| |||||||||||||| ||| |||||||| |
|
|
| T |
17336 |
atatccccgtgaacttaactcagttgatagggatattgcattttacatgcaggg |
17283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0276 (Bit Score: 33; Significance: 0.000000006; HSPs: 1)
Name: scaffold0276
Description:
Target: scaffold0276; HSP #1
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 1260 - 1308
Alignment:
| Q |
46 |
cctgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||| ||||||| |||| |
|
|
| T |
1260 |
cctgtgagcttagctcagctggtaggaatattgcattttatatgtaggg |
1308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 33; Significance: 0.000000006; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 1320 - 1364
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
93 |
Q |
| |
|
||||||||| ||||||||||||| |||||| |||||||||||||| |
|
|
| T |
1320 |
gtgagcttaactcagttggtaggaatattgtatattatatgcagg |
1364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0117 (Bit Score: 33; Significance: 0.000000006; HSPs: 1)
Name: scaffold0117
Description:
Target: scaffold0117; HSP #1
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 18484 - 18444
Alignment:
| Q |
96 |
cggacaccccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
18484 |
cggacaccccacttctccacaattaaattgtgtgagctcta |
18444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116 (Bit Score: 33; Significance: 0.000000006; HSPs: 1)
Name: scaffold0116
Description:
Target: scaffold0116; HSP #1
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 95 - 131
Target Start/End: Complemental strand, 20198 - 20162
Alignment:
| Q |
95 |
acggacaccccacttcttcacaatttaattgtgtgag |
131 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20198 |
acggacactccacttcttcacaatttaattgtgtgag |
20162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 33; Significance: 0.000000006; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 55 - 91
Target Start/End: Original strand, 510965 - 511001
Alignment:
| Q |
55 |
ttagctcagttggtagggatattgcatattatatgca |
91 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
510965 |
ttagctcagttagtagggatattgcatattatatgca |
511001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 92
Target Start/End: Complemental strand, 8983 - 8940
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcag |
92 |
Q |
| |
|
|||||| || |||| ||||||||||||||||||||||||||||| |
|
|
| T |
8983 |
gtgagcataactcaattggtagggatattgcatattatatgcag |
8940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 32; Significance: 0.00000002; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 136
Target Start/End: Original strand, 39716 - 39751
Alignment:
| Q |
101 |
accccacttcttcacaatttaattgtgtgagctcta |
136 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39716 |
accccacttcttcacaattaaattgtgtgagctcta |
39751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 94
Target Start/End: Original strand, 39664 - 39694
Alignment:
| Q |
64 |
ttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39664 |
ttggtagggatattgcatattatatgcaggg |
39694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 31; Significance: 0.0000001; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 94
Target Start/End: Original strand, 94657 - 94699
Alignment:
| Q |
52 |
agcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | |||||||||| |
|
|
| T |
94657 |
agcttagctcagttggtatggatattgcatgtcatatgcaggg |
94699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068 (Bit Score: 30; Significance: 0.0000004; HSPs: 1)
Name: scaffold0068
Description:
Target: scaffold0068; HSP #1
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 45913 - 45958
Alignment:
| Q |
49 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggg |
94 |
Q |
| |
|
|||| ||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
45913 |
gtgatcttagctcagttggtagagatattatatattatatgcaggg |
45958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University