View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9016_low_25 (Length: 353)
Name: NF9016_low_25
Description: NF9016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9016_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 2325214 - 2325352
Alignment:
| Q |
1 |
aaggaagatgggaaagagcggaattgcacacactaagtttaaagaagagcggtattttactatatgaacattacttataatatgatatgataaatgttaa |
100 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2325214 |
aaggaagatggtaa-gagcggaattgcacacactaagtttaaagaagagcggtattttactatatgaacattacttataatatgatatgataaatgttaa |
2325312 |
T |
|
| Q |
101 |
atagtgcctcctagacactcttttaaaaatgttaattgat |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2325313 |
atagtgcctcctagacactcttttaaaaatgttaattgat |
2325352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 213 - 334
Target Start/End: Original strand, 2325425 - 2325546
Alignment:
| Q |
213 |
cttaatttgcaatctttaaaaagtatcctgaaaactctttttagcaagaccgttatgatataaatacattactcgtgtgtggaaaatgatataggtaaga |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2325425 |
cttaatttgcaatctttaaaaagtatcctgaaaactctttttagcaagatcgttatgatataaatacattactcgtgtgtggaaaatgatataggtaaga |
2325524 |
T |
|
| Q |
313 |
cataataaacacacacctcaaa |
334 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2325525 |
cataataaacacacacctcaaa |
2325546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University