View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9016_low_41 (Length: 214)
Name: NF9016_low_41
Description: NF9016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9016_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 26314439 - 26314565
Alignment:
| Q |
1 |
atcaccaagatagataaatcttttatttttctcacttgatatagagtcttggattctctttatgattagtccctataatcatatgatttagaatatgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||| ||||||| ||| |
|
|
| T |
26314439 |
atcaccaagatagataaatcttttatttttctcacttgatatagagtcttggattctctttatgattagtccctgtaatgatttgatgtagaataagaac |
26314538 |
T |
 |
| Q |
101 |
ttggcatagaacattatatatatgact |
127 |
Q |
| |
|
|||||||| ||||||||||| |||||| |
|
|
| T |
26314539 |
ttggcataaaacattatatacatgact |
26314565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 5 - 116
Target Start/End: Original strand, 43109392 - 43109503
Alignment:
| Q |
5 |
ccaagatagataaatcttttatttttctcacttgatatagagtcttggattctctttatgattagtccctataatcatatgatttagaatatgaatttgg |
104 |
Q |
| |
|
|||||||||||||| |||||||| | |||| ||||||||| ||||||||||| ||||||||||| |||| |||| ||||||| | ||||| ||| |||| |
|
|
| T |
43109392 |
ccaagatagataaaccttttattctcttcacatgatatagactcttggattctatttatgattagaccctgtaatgatatgatatggaataagaacttgg |
43109491 |
T |
 |
| Q |
105 |
catagaacatta |
116 |
Q |
| |
|
||||||| |||| |
|
|
| T |
43109492 |
catagaatatta |
43109503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 198
Target Start/End: Original strand, 26314657 - 26314689
Alignment:
| Q |
166 |
atatagatagatattagatatacaccttgcaca |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26314657 |
atatagatagatattagatatacaccttgcaca |
26314689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University