View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9018_low_10 (Length: 252)
Name: NF9018_low_10
Description: NF9018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9018_low_10 |
 | |
|
| [»] scaffold0101 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0101 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: scaffold0101
Description:
Target: scaffold0101; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 81 - 229
Target Start/End: Complemental strand, 14635 - 14487
Alignment:
| Q |
81 |
gatgtctttgtaattatgttttgctgatcagtgacttggttcagagaatgatgctactcttgttgagtgccagagaagtctcttctttctcaatcacact |
180 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14635 |
gatgtctttgtaattatgtttttctgatcagtgacttggttcagagaatgatgctactcttgtttagtgccagagaagtctcttctttctcaatcacact |
14536 |
T |
|
| Q |
181 |
gcaatttggtaaattttccttctgaagtggagaaattggagatcagtgc |
229 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14535 |
gcaatttggtaaattttccttatgaagtggagaaattggagatcagtgc |
14487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0101; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 3 - 85
Target Start/End: Complemental strand, 16686 - 16604
Alignment:
| Q |
3 |
atattttaacttacgacatcttctggttctatcttcctcttctatttcaagattctggagaaactaaggttacatagggatgt |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
16686 |
atattttaacttacgacatcttctggttctatcttccgcttctaattcaagattatggagaaactaaggttagatagggatgt |
16604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University