View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9018_low_13 (Length: 212)
Name: NF9018_low_13
Description: NF9018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9018_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 31337221 - 31337400
Alignment:
| Q |
17 |
agcagaggtatgtagagacagaacatcacttgtttatggttctttgaagtataattggggtcaaactcatcaacgttgtctcaaactcgcttctgctctc |
116 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31337221 |
agcaaaggtttgtagagacagaacatcacttgtttatggttctttgaagtataattggggtcaaactcatcaacgttgtctcaaactcgcttctgctctc |
31337320 |
T |
|
| Q |
117 |
tcccagttggggatttctcgtggagataaggtcagttctctctgtcatactatctatcattagagtaatagtaatgtttt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31337321 |
tcccagttggggatttctcgtggagataaggtcagttctctctgtcatactatctatcattagagttatagtaatgtttt |
31337400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 17 - 143
Target Start/End: Original strand, 31315173 - 31315299
Alignment:
| Q |
17 |
agcagaggtatgtagagacagaacatcacttgtttatggttctttgaagtataattggggtcaaactcatcaacgttgtctcaaactcgcttctgctctc |
116 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
31315173 |
agcaaaggtttgtagagacagaacatcacttgtttatggttctttgaagtataattggggtcaaactcatcaacgttgtctcaaacttgcttcttctctt |
31315272 |
T |
|
| Q |
117 |
tcccagttggggatttctcgtggagat |
143 |
Q |
| |
|
||||||| |||||||| ||||||||| |
|
|
| T |
31315273 |
acccagttagggatttcccgtggagat |
31315299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University