View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9019_high_7 (Length: 250)
Name: NF9019_high_7
Description: NF9019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9019_high_7 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 3 - 250
Target Start/End: Original strand, 46170482 - 46170730
Alignment:
| Q |
3 |
tacctcaattgttgatgtcatgttggactaagtattaacctcacatctaggttagcatttggaccattaatttatggaaggacttgattgaaacgaaatg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46170482 |
tacctcaattgttgatgtcatgttggactaagtattaacctcacatctaggttagcatttggaccattaatttatggaaggacttgattgaaacgaaatg |
46170581 |
T |
 |
| Q |
103 |
taacaatcgaaataattgaagactt-aattagttggttgcttagggacaaaatttacacaactaagcatgcataaacatgatttatgagacaacgagttt |
201 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46170582 |
taacaatcgaaataattgaagacttaaattagttggttgcttagggacaaaatttatacaactaagcatgcataaacatgatttatgagacaacgagttt |
46170681 |
T |
 |
| Q |
202 |
ggtaacccacannnnnnnngcttacgatggttgatttgatttagtacct |
250 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46170682 |
ggtaacccacattttttttgcttacgatggttgatttgatttagtacct |
46170730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University