View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9019_high_9 (Length: 203)
Name: NF9019_high_9
Description: NF9019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9019_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 39192923 - 39192745
Alignment:
| Q |
1 |
tcaatcacctttttataagaaaaaattatcaattacctattgatagttaaagattgcatagatatttaatatgttgtgtgcgattttgaactcatgttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
39192923 |
tcaatcacctttttataagaaaaaattatcaattacctattgatagttaaagattgcatagatatttaatatgttgtgtgcgatttttaact-atgttta |
39192825 |
T |
 |
| Q |
101 |
atgtgtttgagttttgtcagtcagctatttgaaattatatacatagttttcttttgttttgtttaaattagcttatttaaa |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||| |
|
|
| T |
39192824 |
atgtgtttgagttttgtcagtcagctatttgaaattatatagatagtttt-tttttttttgtttaaagtagcttatttaaa |
39192745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University