View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9019_low_25 (Length: 202)
Name: NF9019_low_25
Description: NF9019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9019_low_25 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 32243436 - 32243620
Alignment:
| Q |
18 |
cagagagcaggagacagaggatataccgttcatcttgtgattggcatggcagggcaagacaagcaatccatctggaaaacaagaccgggtcatcccaatg |
117 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32243436 |
cagagagcaagagacaaaggatataccgttcatcttgtgattggcatggcagggcaagacaagcaatccatctggaaaacaagaccgggtcatcccaatg |
32243535 |
T |
|
| Q |
118 |
actcgatctttccacaaccaaaacggtctttgtatcgtgggggtgaatttgggtacattagactagtggctacaaagcagaagct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32243536 |
actcgatctttccacaaccaaaacggtctttgtatcgtgggggtgaatttgggtacattagactagtggctacaaagcagaagct |
32243620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 40 - 199
Target Start/End: Original strand, 32248539 - 32248698
Alignment:
| Q |
40 |
ataccgttcatcttgtgattggcatggcagggcaagacaagcaatccatctggaaaacaagaccgggtcatcccaatgactcgatctttccacaaccaaa |
139 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||| |||| |||| ||| | ||||||||| ||||||| ||| | | |||| |||||||||||| |
|
|
| T |
32248539 |
ataccattcatcttgtgatcggcatggcagggcaagactggcaacccatgtggcgaccaagaccggatcatcccgatgtcccaatctatccacaaccaaa |
32248638 |
T |
|
| Q |
140 |
acggtctttgtatcgtgggggtgaatttgggtacattagactagtggctacaaagcagaa |
199 |
Q |
| |
|
||| |||||||| || |||||||| || || ||||||||| | |||||||||||||||| |
|
|
| T |
32248639 |
acgatctttgtaccgcgggggtgagttcggatacattagattgatggctacaaagcagaa |
32248698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University