View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9020_high_4 (Length: 282)
Name: NF9020_high_4
Description: NF9020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9020_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 3e-94; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 43 - 250
Target Start/End: Original strand, 42576597 - 42576803
Alignment:
| Q |
43 |
agtacatatgataaatttagggagtaaaactgggtttggttaagtcatgtataaaataaattttgtttttcgtttacttaattatttgtgtctagaaaat |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42576597 |
agtacatatgataaatttagggagtaaaactgggtttggttaagtcatgtataaaataaattt-gtttttcgtttacttaattatttgtgtctagaaaat |
42576695 |
T |
 |
| Q |
143 |
gtcaatttannnnnnngataatacaaatgtcaaaaaagtcaaaatctaaacaaaatgatagaagaggttttagtaggggtttagaaaaagcaaccgggaa |
242 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42576696 |
gtcaatttatttttttgataatacaaatgtcaaaaaagtcaaaatctaaacaaaatgatagaagatgttttagtaggggtttagaaaaagcaaccgggaa |
42576795 |
T |
 |
| Q |
243 |
ttgagaac |
250 |
Q |
| |
|
|||||||| |
|
|
| T |
42576796 |
ttgagaac |
42576803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 42576576 - 42576534
Alignment:
| Q |
1 |
attaagtaccaatacatattaattttgtttctttcaataaaaa |
43 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42576576 |
attaagtaccaatacatattaactttgtttctttcaataaaaa |
42576534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 198 - 250
Target Start/End: Original strand, 42569710 - 42569762
Alignment:
| Q |
198 |
tgatagaagaggttttagtaggggtttagaaaaagcaaccgggaattgagaac |
250 |
Q |
| |
|
|||| ||||||||||||| |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
42569710 |
tgatggaagaggttttagcagggctttagaaaaagcaaccgagaattgagaac |
42569762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 42593660 - 42593708
Alignment:
| Q |
203 |
gaagaggttttagtaggg-gtttagaaaaagcaaccgggaattgagaac |
250 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||| ||||||| |
|
|
| T |
42593660 |
gaagaggttttagtagggtgtttagtaaaagcaaccgggaagtgagaac |
42593708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University