View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9020_low_15 (Length: 260)
Name: NF9020_low_15
Description: NF9020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9020_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 256
Target Start/End: Original strand, 36453736 - 36453976
Alignment:
| Q |
16 |
ctcttcttgtggatgtggttggtaaacaaagaccaagacaatcatctaaatgttgggcataattaaatcctaaaccaggaatttgtttacaatagaaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36453736 |
ctcttcttgtggatgtggttggtaaacaaagaccaagacaatcatctaaatgttgggcataattaaatcctaaaccaggaatttgtttacaatagaaaaa |
36453835 |
T |
|
| Q |
116 |
agtaatatcttgtcattcttttagaagtaatcacatactatatttatgnnnnnnnnataaggaagactatattttccttatgttatagtatgaagttttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36453836 |
agtaatatcttgtcattcttttagaagtaatcacatactatatttatgttttttttttaaggaagactatattttccttatgttatagtatgaagttttc |
36453935 |
T |
|
| Q |
216 |
acatgatgattaatctttgtagaaaaccacaggttctgctc |
256 |
Q |
| |
|
| | ||||||||||||||||||||||||| || |||||||| |
|
|
| T |
36453936 |
aaaggatgattaatctttgtagaaaaccatagattctgctc |
36453976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University