View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9021_low_25 (Length: 395)
Name: NF9021_low_25
Description: NF9021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9021_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 18 - 379
Target Start/End: Original strand, 6626262 - 6626623
Alignment:
| Q |
18 |
gggtgaacactgggaggaggtgcagttgttgggtattcgagagataacctttcacggcgtgcagctgttgggtagtcaagggataaccttggtaggggtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6626262 |
gggtgaacactgggaggaggtgcagttgttgggtattcaagagataacctttcacggcgtgcagctgttgggtagtcaagggataaccttggtaggggtg |
6626361 |
T |
|
| Q |
118 |
aagaagatctagctgggcttttggggttttttcctccaggactttgatggggagaagaggcgccatcaatgcctgatgcagataaatcaaagaaagcagg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6626362 |
aagaagatctagctgggcttttggggttttttcctccaggactttgatggggagaagaggcaccatcaatgcctgacgcagataaatcaaagaaagcagg |
6626461 |
T |
|
| Q |
218 |
aggtggttgccccgtagatgttggcatttctggtgcagaccagaattgatttgcttttggtgacacataataatatggcacaaaatcatcttgtttggtg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6626462 |
aggtggttgccccgtagatgttggcatttctggtgcagaccagaattgatttgcttttggtgacacataataatatggcacaaaatcatcttgtttggtg |
6626561 |
T |
|
| Q |
318 |
tcatatgggctgattgtgggactggtaaagggagtatttgaagtactagtactccttggagg |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6626562 |
tcatatgggctgattgtgggactggtaaagggagtatttgaagtactagtactccttggagg |
6626623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University