View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9021_low_44 (Length: 237)
Name: NF9021_low_44
Description: NF9021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9021_low_44 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 6095532 - 6095329
Alignment:
| Q |
18 |
catcatgcaatgtgtgaggatagaaactcggagcaggctgaatcctcaaatagcaacaattatgagatatggaagcgtatttggagtattcctgtcccta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
6095532 |
catcatgcaatgtgtgaggatagaaactcggagcaggctgaatcctcaaatagcaacaattctgagatatggaagcgtatttggagtactcccgtcccta |
6095433 |
T |
|
| Q |
118 |
aaagtgcacaaaatttcttatggaggttggc-aaaaatatccttccaactagaagtaatttgggtaagaaaggtatatccctggatatgagttgtcctct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6095432 |
aaagtgcacaaaatttcttatggaggttgacaaaaaatatccttccaactagaagtaatttgggtaagaaaggtatatccctggatatgagttgtcctct |
6095333 |
T |
|
| Q |
217 |
ttgt |
220 |
Q |
| |
|
|||| |
|
|
| T |
6095332 |
ttgt |
6095329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 32805385 - 32805588
Alignment:
| Q |
18 |
catcatgcaatgtgtgaggatagaaactcggagcaggctgaatcctcaaatagcaacaattatgagatatggaagcgtatttggagtattcctgtcccta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| ||||| ||||||| |
|
|
| T |
32805385 |
catcatgcaatgtgtgaggatagaaactcagagcaggctgaatcctcaaatagcaacaattctgagatttggaagcgtatttggagcattcccgtcccta |
32805484 |
T |
|
| Q |
118 |
aaagtgcacaaaatttcttatggaggttggc-aaaaatatccttccaactagaagtaatttgggtaagaaaggtatatccctggatatgagttgtcctct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32805485 |
aaagtgcacaaaatttcttatggaggttggcaaaaaatatccttccaactagaagtaatttgggtaagaaaggtatatccctggatatgagttgtcctct |
32805584 |
T |
|
| Q |
217 |
ttgt |
220 |
Q |
| |
|
|||| |
|
|
| T |
32805585 |
ttgt |
32805588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University