View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9022_low_16 (Length: 237)
Name: NF9022_low_16
Description: NF9022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9022_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 11 - 217
Target Start/End: Complemental strand, 32982034 - 32981831
Alignment:
| Q |
11 |
atcatcagaatcatcatgttgtgctatgattgatattttgggcgactggtatcgagagcaacaacggataattaatcaatctacaaatagagattgtaca |
110 |
Q |
| |
|
||||| ||||||| |||||| |||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
32982034 |
atcataagaatcaacatgttctgctatgattgatattttgggcgaa--gtattgagagcaacaacgaataattaatcaatctacaaagggagattgtaca |
32981937 |
T |
 |
| Q |
111 |
catctccacgactccacccaaaattgtgattcattaagaatgtttgatcacctatattatgtagggtcatattaacagatgttcgtgggacacttttaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
32981936 |
catctccacgactccacccaaaatcgtgattcattaagaatgtttgatcacctatattatgtagggtcatattaaca-atgtccgtgggacacttttaaa |
32981838 |
T |
 |
| Q |
211 |
ggttatg |
217 |
Q |
| |
|
||||||| |
|
|
| T |
32981837 |
ggttatg |
32981831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University