View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9022_low_7 (Length: 474)
Name: NF9022_low_7
Description: NF9022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9022_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 375; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 21 - 447
Target Start/End: Original strand, 7896234 - 7896659
Alignment:
| Q |
21 |
gtcacaaagtccacattatcaaatttcatgtctgttaaccattgaatggcatgaaacagccccatggcttctccaacatcaacagcaagttgtgtgggaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7896234 |
gtcacaaagtccacattatcaaatttcatgtctgttaaccattgaatggcatgaaacagccccatggcttctccaacatcaacagcaagttgtgtgggaa |
7896333 |
T |
 |
| Q |
121 |
atctccttgtttgcgcaagtacatacgtaccgttgtcatcacgcaaacaaacaccaataccgttacggttccacaccgaggaaaaagcggcgtcaatgtt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
7896334 |
atctccttgtttgcgcaagtacatacgtgccgttgtcatcacacaaacaaacaccaatacccgtacggttccacac-gaggaaaaagtggcgtcaatgtt |
7896432 |
T |
 |
| Q |
221 |
gcatttgaaacgaccctgctgcggtttctgccatacacatgcatttgcctgtacagactgtcggtgctgatctgctcgtgaaccgtgtgaaaccgaggaa |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7896433 |
gcatttgaaacgaccctgctgcggtttctgccatacacatgcattttcctgtacagactgtccgtgctgatctgctcgtgaaacgtgtgaaaccgaggaa |
7896532 |
T |
 |
| Q |
321 |
tgagtcgaagttgtattcaccgatacccaaccctccataaggttttgagctctaaaaatcacttgggcagccgtctcattttcattttgccatagcttgt |
420 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7896533 |
tgagtcgaagttgtattcaccgatacccaaccctccataaggttttaagctctaaaaatcacttgggcagccgtctcgttttcattttgccatagcttgt |
7896632 |
T |
 |
| Q |
421 |
tattacggtgcttccataaactccata |
447 |
Q |
| |
|
|||| |||||||||||||||||||||| |
|
|
| T |
7896633 |
tattgcggtgcttccataaactccata |
7896659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University