View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9023_low_23 (Length: 307)
Name: NF9023_low_23
Description: NF9023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9023_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 774487 - 774776
Alignment:
| Q |
1 |
gagcaaggaatgttatattatgatattaatattcatacactattaatctcaagtattttacactatcagcgaatcacaatcactcataaatgtaatttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
774487 |
gagcaaggaatgttatattatgatattaatattcatacactattaatctcaagtattttacactatcagcgaatcacaatcactcataaatgtaatttta |
774586 |
T |
|
| Q |
101 |
gaatgttattttgcatgatcacaatgtggttaatgcatttataagtcaagtaagctccatcatgcttagttt--agaacttaaagatcattcatggttta |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
774587 |
gaatgttattttgcatgatcacaatgtggttaatgcatttataagtcaagtaagctccatcatgcttagttttcagaacttaaagatcattcatggttta |
774686 |
T |
|
| Q |
199 |
aaattgacaattgatcatggttttcattgttataggttatgactcaaaagttgtgattttgttgatcttagatgggtgcgacacaaaaca |
288 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
774687 |
aaatcgacaattgatcatggttttcattgttataggttatgactcaaaagttgtgattttgttgatcttagatgggtgcgacacaaaaca |
774776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University