View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9023_low_26 (Length: 306)
Name: NF9023_low_26
Description: NF9023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9023_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 288
Target Start/End: Complemental strand, 14056985 - 14056715
Alignment:
| Q |
14 |
agactaaaattaataactcaatttcatttttcgccgttagtctccctctccctctctctcacacaca--tctatgtcgccatataaaagaaagaattaag |
111 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
14056985 |
agactaaaattaataactcagtttcatttttcgccgttagtctccctctccttctctctcacacacacatctatgtcgccatataaaagaaggaattaag |
14056886 |
T |
 |
| Q |
112 |
aattttcggggcatccttataattaaaaaatatagtttaggggcaccaccatgcaaatatcataaatttacacatggtggtggtcatgatgcaagggatg |
211 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14056885 |
aattttcggggcatcctta------aaaaatatagtttaggggcaccaccatgcaaatatcataaatttacacatggtggtggtcatgatgcaatggatg |
14056792 |
T |
 |
| Q |
212 |
ggcgtggatgaggaatttgattacctgcaagaactgaatagtcacctgttaggggaataccttccgtttagatgtaa |
288 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14056791 |
ggcgtggatgaggaatttgattacacgcaagaactgaatagtcacctgttaggggaataccttccgtttagatgtaa |
14056715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University