View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9023_low_27 (Length: 279)
Name: NF9023_low_27
Description: NF9023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9023_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 41 - 269
Target Start/End: Complemental strand, 44962654 - 44962426
Alignment:
| Q |
41 |
gttctataataagaaactatatagatagcctcttcttaaatgcatagaaaatgaaattggtttctgtgtagttaatttaatttgctcacatgagctgaaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44962654 |
gttctataataagaaactatatagatagcctcttcttaaatgcaaagaaaatgaaattggtttctgtgtagttaatttaatttgctcacatgagctgaaa |
44962555 |
T |
 |
| Q |
141 |
aggaacagtgtcagcctcaacttcaagtaaaggaaaaaactcatgaggattcaatcgaattctaaccaataaaaatgttgaaatagacttcccttataaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44962554 |
aggaacagtgtcagcctcaacttcaagtaaaggaaaaaactcatgaggattcaatcgaattctaaccaataaaaatgttgaaatagacttcccttataaa |
44962455 |
T |
 |
| Q |
241 |
caacacatagtgactgcttgttctctctg |
269 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44962454 |
caacacatagtgactgcttgttctctctg |
44962426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University