View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9023_low_33 (Length: 258)

Name: NF9023_low_33
Description: NF9023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9023_low_33
NF9023_low_33
[»] chr4 (1 HSPs)
chr4 (30-258)||(50840330-50840557)


Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 30 - 258
Target Start/End: Original strand, 50840330 - 50840557
Alignment:
30 atcaacaggcttccttacacgaccatatgtgttacttactgccattactgcctgtgaaggaggaattggcctgaaaagacattgaaatataatattaatg 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50840330 atcaacaggcttccttacacgaccatatgtgttacttactgccattactgcctgtgaaggaggaattggcctgaaaagacattgaaatataatattaatg 50840429  T
130 tagtcagaattcagatcagaaccagaacgaagtttcataaaatnnnnnnntagcaaaacaagaacgtcataatacatttagtatagaatgtagatggaaa 229  Q
    ||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||| ||||||||||||||||||||||||||||    
50840430 tagtcagaattcagatcagaaccagaacgaagtttcataaaa-aaaaaaatagcaaaacaagaacgtcatattacatttagtatagaatgtagatggaaa 50840528  T
230 aacaatattcactgttttcttgtattcaa 258  Q
    |||||||||||||||||||||||||||||    
50840529 aacaatattcactgttttcttgtattcaa 50840557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University