View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9023_low_46 (Length: 222)
Name: NF9023_low_46
Description: NF9023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9023_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 24 - 208
Target Start/End: Original strand, 7145108 - 7145292
Alignment:
| Q |
24 |
attcgttggaattacctgtccataattcactctaaaataatatattttcaccaattcccatttcacttctgataagttttggaaatcagtttggttcaat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7145108 |
attcgttggaattacctgtccataattcactccaaaataatatattttcaccaattcccatttcacttctgataagttttggaaatcagtttggttcaat |
7145207 |
T |
 |
| Q |
124 |
tgagcataaatcacaacaccataacaaatccaaccatcctccaatctccactgtccgggctgagcaaattttgttattgtctgtg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7145208 |
tgagcataaatcacaacaccataacaaatccaaccatcctccaatctccactgtccgggctgagcaaattttgttattgtctgtg |
7145292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University