View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9024_low_11 (Length: 278)
Name: NF9024_low_11
Description: NF9024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9024_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 15770681 - 15770489
Alignment:
| Q |
1 |
gatgttccatcatttacaagtcttccaaggtataaagaattaatatgattctttggatatactgaaatggatgagattagtagcttaattccaaaccggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15770681 |
gatgttccatcatttacaagtcttccaaggtataaagaattaatatgattctttggatatactgaaatggatgagattagtagcttaattccaaaccggt |
15770582 |
T |
|
| Q |
101 |
cttgaatatgacatatgagcaaaatctatagtgacaaatgcataggattagcatttgcactttctaggtaacatcctccaacaatgtctcttt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
15770581 |
cttgaatatgacatatgagcaaaatctatagtgacaaatgcataggattagcatttgcactttctaggtaacatcctccgacaatgtttcttt |
15770489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 71 - 151
Target Start/End: Original strand, 15796123 - 15796204
Alignment:
| Q |
71 |
atgagattagtagcttaattccaaaccggtcttgaatatgacatatgagcaaaatctatagtgacaaatgca-taggattag |
151 |
Q |
| |
|
|||||||| ||||||| ||||||| |||| | |||| ||||||||||| |||||||||||| ||||||| || ||||||||| |
|
|
| T |
15796123 |
atgagattggtagcttgattccaagccggccatgaacatgacatatgaacaaaatctatagcgacaaatacattaggattag |
15796204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University