View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9025_low_11 (Length: 352)
Name: NF9025_low_11
Description: NF9025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9025_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 64 - 341
Target Start/End: Complemental strand, 38877286 - 38877009
Alignment:
| Q |
64 |
gaatggttgcagataatggaatggatgatgatgaggcaaattaatttttcatgggataactatgcagtgtatttagatcttgtgtccaaagtgaaaggag |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38877286 |
gaatggttgcagataatggaatggatgatgatgaggcaaattaatttttcatgggataactatgcagtgtatttagatcttgtgtccaaagtgaaaggag |
38877187 |
T |
|
| Q |
164 |
tggttgaagccgagaatcacttcaacagtttttctcctcctgctaagaacaagtacacatacggttctcttctaaactgttactgcaaggaactaatgct |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38877186 |
tggttgaagccgagaatcacttcaacagttttcctcctcctgctaagaacaagtacacatacggttctcttctaaactgttactgcaaggaactaatgct |
38877087 |
T |
|
| Q |
264 |
agacaaggcattgtctcattttgataagatggatgaattaggttatttgactagtttgtctttcaccaatttgatgtc |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38877086 |
agacaaggcattgtctcattttgataagatggatgaatttggttatttgactagtttgtctttcaccaatttgatgtc |
38877009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University