View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9025_low_9 (Length: 394)
Name: NF9025_low_9
Description: NF9025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9025_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 19 - 382
Target Start/End: Complemental strand, 15506079 - 15505705
Alignment:
| Q |
19 |
cactgcccataaaattttcccatatagacatgaccctaataacttcaagtttagtttctccaaatggttgattgttgaggagttaacaaaaggtttcctt |
118 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
15506079 |
cactgcccataaaattatccggtatagacatgaccctaataacttcaagtttagtttctccaaatggttgactgttgaggagttttcaaaaggtttcctg |
15505980 |
T |
|
| Q |
119 |
gtattgtgttgccctttttgtcttctgatatcattcaactttagccattaatgtcac-----------taacaactgtttttgtgtttttacagaccctt |
207 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||||| |
|
|
| T |
15505979 |
gtatggtgttgccctttttgtcttctgatatcattcaactttagccattaatgtcaccccaatgtcactaacaattgttttgatgtttttacagaccctt |
15505880 |
T |
|
| Q |
208 |
tcatatgatagttttttgaactctgtgatgcccatagataccaaggagttctatttaacagatgacaccgaccatgtctggagttgtactcaatcttttg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
15505879 |
tcatatgatagttttttgaactctgtgatggccatagataccaaggacttctatttaacagatgacaccggccatgtctggagttgcactcaatcttttg |
15505780 |
T |
|
| Q |
308 |
tcagttccaaaaaaccgcactacaaaattcaaggagaatggaagcaattctgtttaagccgcaatgtgattgctg |
382 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
15505779 |
tcagttccaaagaaccgcactacaaaattcaaggagaatggaagcaattttgtttaagctgcaatgtgattgctg |
15505705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University