View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9026_high_15 (Length: 396)
Name: NF9026_high_15
Description: NF9026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9026_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 373
Target Start/End: Original strand, 9072749 - 9073097
Alignment:
| Q |
18 |
caatgggcactattgcttcactcttatgggattttcagagagtaataattgtggtaaagatccaccatttgaacnnnnnnnatctcttcattacaaattt |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
9072749 |
caatgtgcactattgcttcactcttatgggattttcagagagtaataattgtggtaaagatccaccatttgaactttttttatctcttcgttacaaattt |
9072848 |
T |
|
| Q |
118 |
ttagtattctctgtaaattttgactactca---accttcatttaatctctattgttagacctaactcaacctttttaaaattaatttccaaacgatgaca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9072849 |
ttagtattctctgtaaattttgactactcatcaaccttcatttaatctctattgttagacctaactcaaccttttcaaaattaatttccaaacgatgaca |
9072948 |
T |
|
| Q |
215 |
tgccccgtgtattcatttttacatcatttataatcaaatgctttttgacnnnnnnnnnnnnnnnnttataaagaaaaatagttgtatgatcacaactata |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9072949 |
tgccccgtgtattcatttttacatcatttataatcaaaagcttttcgac------aaaaaaaaaattataaagaaaaatagttgtatgatcacaactata |
9073042 |
T |
|
| Q |
315 |
aataaaataatccttgttaggcacacacatactagatgactttatttcattatatctct |
373 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9073043 |
aata----aatcctagttaggcacacacatactagatgactttatttcattatatctct |
9073097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University