View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9026_high_28 (Length: 220)
Name: NF9026_high_28
Description: NF9026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9026_high_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 3022309 - 3022110
Alignment:
| Q |
1 |
agcgagaagaaagagctaggtagctatgtcattattgctacaagacaatatgagggaaaacattagaagatnnnnnnnctctatgttggcgggcgtacat |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3022309 |
agcgagaagaaagagctgggtagctatgtcattattgctacaagacaatatgagggaaaacattagaagataaaaaaactctatgttggcgggcgtacat |
3022210 |
T |
|
| Q |
101 |
aggtagttactctgaattggcctttggagaaggctctcnnnnnnnttcagaatatagtggattgtaatgtattaatggtcccatagaattgggaaagaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
3022209 |
aggtagttactctgaattggcctttggagaaggctctcaagaggactcagaatgtagtggattgtaatgtatgaatggt-ccatagaattgggaaagaga |
3022111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University