View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9026_low_64 (Length: 226)
Name: NF9026_low_64
Description: NF9026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9026_low_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 6 - 213
Target Start/End: Original strand, 20517678 - 20517885
Alignment:
| Q |
6 |
taagtaatatactatcctcgatcacattaacctagaaagattacagcgaaataaacagactacaagatagatgaatggttatcttagttatcatggaaaa |
105 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||| | ||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
20517678 |
taagtaatatactctcctcgatcacattcacctagaaagattacaacagaataaacagactacaagatagatcaatggttatctcagttatcatggaaaa |
20517777 |
T |
 |
| Q |
106 |
ctgcaacgtcaggaagagcttgattagttaagacaattcagccgacatcattgttcgtgacacttacaaatgactagggactctagtgtcaactttaaag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| || |||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
20517778 |
ctgcaacgtcaggaagagcttgattagtcaagacaatttagtcgacatcattgttcgtgacacttacacatgactagggatactagtgtcaactttaaag |
20517877 |
T |
 |
| Q |
206 |
ctatatct |
213 |
Q |
| |
|
|||||||| |
|
|
| T |
20517878 |
ctatatct |
20517885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University