View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9027_low_13 (Length: 426)
Name: NF9027_low_13
Description: NF9027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9027_low_13 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 63 - 426
Target Start/End: Original strand, 14192871 - 14193240
Alignment:
| Q |
63 |
ggttgctcaatatgtggaggtctggaacgatcatcgggttgctagaattgtgcagagggcattcggttaccctttacaaaataccaggggctgtgctcat |
162 |
Q |
| |
|
|||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||||| |
|
|
| T |
14192871 |
ggttgctcaacatgtgcaggtttggaacgatcatcgggttgctagaattgtgcagagggcattcggttaccctcttcagaataccaggggctgtgctcat |
14192970 |
T |
 |
| Q |
163 |
atacttgattttatgcacttttctactgtgacagacagccggattagagatgcaaagccagcaaggcaagagctagttcgatgcgctactaagcttctag |
262 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14192971 |
atacttgatttaatgcacttttctactgtggaagacagccggattagagatgcaaagccagcaaggcaagagctagttcgatgcgctactagtcttctag |
14193070 |
T |
 |
| Q |
263 |
ctgctgggataatcatcattccagtac---gccaggtgcnnnnnnntccggaggtaattgatttgacggatacattcgactttaatataagttttgacga |
359 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||| ||| ||||| |||||||||||||||||||||||||||||||| |||| ||| | |
|
|
| T |
14193071 |
ctgctgggataatcatcattccagtaccctgcctggtggaacgaaatccccaggtacttgatttgacggatacattcgactttaatatacgtttggacta |
14193170 |
T |
 |
| Q |
360 |
t---acagggaagctaggaatcccggtgttgaatgtcaaggaaacaacggaagtgaggtggaggaatttg |
426 |
Q |
| |
|
| || ||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14193171 |
tataacgggggagctacgaatcccggtgttgaatttcaaggaaacaacggaagtgaggtggaggaatttg |
14193240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 426
Target Start/End: Original strand, 18521891 - 18521933
Alignment:
| Q |
384 |
gttgaatgtcaaggaaacaacggaagtgaggtggaggaatttg |
426 |
Q |
| |
|
|||| |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
18521891 |
gttgtatgttaaggaaacaacggaagtgaagtggaggaatttg |
18521933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University