View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9027_low_30 (Length: 294)
Name: NF9027_low_30
Description: NF9027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9027_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 25 - 284
Target Start/End: Complemental strand, 35380547 - 35380292
Alignment:
| Q |
25 |
aatgtaactcaactcagtattctctttgactttacttacacgatggtgtgaccactcttttcttttgaaatgtcacacttattacgatacagattaacct |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35380547 |
aatgtaactcaactcagtattctctttgactttacttacacgatggtgtgaccactcttttcttttgaaatgtcacacttattacgatacagattaacct |
35380448 |
T |
 |
| Q |
125 |
gcaaaggggtggatactctaaattttgaatcaacccaacgtttaattattgtattaaattgtcagtttatatgaaacagtgaccacaaaatgattatgca |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35380447 |
gcaaaggggtggatactctaaattttgaatcaacccaacgtttaattattgtattaaattgtcagtttatatgaaacagtgaccacaaaatgattatgca |
35380348 |
T |
 |
| Q |
225 |
ttgtaataattaattaatgtagacacaaaatgctgcatatatcttcactggacttctctg |
284 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35380347 |
ttgtaataat----taatgtagacacaaaatgctgcatatatcttcactggacttctctg |
35380292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University