View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9027_low_41 (Length: 211)

Name: NF9027_low_41
Description: NF9027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9027_low_41
NF9027_low_41
[»] chr5 (2 HSPs)
chr5 (135-211)||(35786792-35786868)
chr5 (14-45)||(35786958-35786989)


Alignment Details
Target: chr5 (Bit Score: 77; Significance: 6e-36; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 135 - 211
Target Start/End: Complemental strand, 35786868 - 35786792
Alignment:
135 gtcctttacttcctcgtccttctggtttctcagtttacaataattttgtcccatttggtgtttacaataattttcat 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35786868 gtcctttacttcctcgtccttctggtttctcagtttacaataattttgtcccatttggtgtttacaataattttcat 35786792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 14 - 45
Target Start/End: Complemental strand, 35786989 - 35786958
Alignment:
14 attattctctatggttctagggctcagcttaa 45  Q
    ||||||||||||||||||||||||||||||||    
35786989 attattctctatggttctagggctcagcttaa 35786958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University