View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9027_low_41 (Length: 211)
Name: NF9027_low_41
Description: NF9027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9027_low_41 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 6e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 135 - 211
Target Start/End: Complemental strand, 35786868 - 35786792
Alignment:
| Q |
135 |
gtcctttacttcctcgtccttctggtttctcagtttacaataattttgtcccatttggtgtttacaataattttcat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35786868 |
gtcctttacttcctcgtccttctggtttctcagtttacaataattttgtcccatttggtgtttacaataattttcat |
35786792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 14 - 45
Target Start/End: Complemental strand, 35786989 - 35786958
Alignment:
| Q |
14 |
attattctctatggttctagggctcagcttaa |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35786989 |
attattctctatggttctagggctcagcttaa |
35786958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University