View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9028_low_15 (Length: 338)
Name: NF9028_low_15
Description: NF9028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9028_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 659496 - 659776
Alignment:
| Q |
1 |
tttcgattggtccaataatatgctctcttcgtgtgttttggatgaaacattgctcctaccaaataccaataatgtttctaaaaatgaagaatatttcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
659496 |
tttcgattggtccaataatatgctctcttcgtgtgttttggatgaaacattgctcctaccaaataccaataatgtttctaaaaatgaagaatatttcatt |
659595 |
T |
|
| Q |
101 |
catcggatcacttggtcatggtatatgcatgagatatgcaaaatgatagaagaaagagtgttctacaaactagaaattgccaactttgtaatggcaaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
659596 |
catcggatcacttggtcatggtatatgcatgagatatgcaaaatgatagaagaaagagtattctacaaactagaaattgccaactttgtaatggcaaatt |
659695 |
T |
|
| Q |
201 |
agagagattgatgagaactaaataaataaaacgagacnnnnnnnnnnncacatttcatagcaagagttcaactaataaaaatg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
659696 |
agagagattgatgagaactaaataaataaaacgagac--aaaaaaaaacacatttcatagcaagagttcaactaataaaaatg |
659776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University