View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9028_low_16 (Length: 323)
Name: NF9028_low_16
Description: NF9028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9028_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 40 - 308
Target Start/End: Complemental strand, 43907529 - 43907261
Alignment:
| Q |
40 |
gaatgagtcttttgatgctcttccttatcagaagaatggacacaagaatactcttctggggcttctttgtcttcttcatcttcttcatcatcagaataca |
139 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43907529 |
gaatgagtcctttgacgctcttccttatcagaagaatggacacaagaatactcttctggggcttcttcgtcttcttcatcttcttcatcatcagaataca |
43907430 |
T |
 |
| Q |
140 |
catattcatactgttgatctctgcaatagatacaaatagaatgttgtaatttaaatacatgttatgggaaaaatgaatgtgctagttgaatgggaggtgt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43907429 |
catattcatactgttgatctctgcaatagatacaaatagaatgttgtaatttaaatacatgttatgggaaaaatgaatgtgctagttgaatgggaggtgt |
43907330 |
T |
 |
| Q |
240 |
agatagaaaaagaagagcattagcaagacctttggattaaggggaatctaccagtgaaggttaagaatg |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43907329 |
agatagaaaaagaagagcattagcaagacctttggattaaggggaatctaccagtgaaggttaagaatg |
43907261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University